View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10194_low_23 (Length: 243)
Name: NF10194_low_23
Description: NF10194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10194_low_23 |
 |  |
|
| [»] scaffold0002 (4 HSPs) |
 |  |  |
|
| [»] scaffold0517 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0106 (1 HSPs) |
 |  |  |
|
| [»] scaffold0562 (1 HSPs) |
 |  |  |
|
| [»] scaffold0765 (1 HSPs) |
 |  |  |
|
| [»] scaffold0230 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 45; Significance: 9e-17; HSPs: 4)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 130 - 189
Target Start/End: Complemental strand, 345959 - 345902
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
345959 |
ttaggctaaaatatgtttttggtccctgc--aaatatagcgaatttgggttttggtccct |
345902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 127 - 182
Target Start/End: Complemental strand, 376434 - 376381
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
376434 |
attttaggctaaaatatgcttttggtccctgc--aaatatagcgagtttgggtttt |
376381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 190
Target Start/End: Original strand, 344934 - 344992
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||| |||| ||||||||||| |||||| |
|
|
| T |
344934 |
ttaggctcaaatatgattttggtccctgc--aaatatggcgagtttgggttttggtccctg |
344992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 189
Target Start/End: Original strand, 374335 - 374389
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
|||||||||||| ||||| ||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
374335 |
ggctaaaatatgattttgatccctgc--aaatatagcgagtttgggttttggtccct |
374389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 20)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 190
Target Start/End: Original strand, 25977860 - 25977925
Alignment:
| Q |
123 |
attaattttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||| |||||| |
|
|
| T |
25977860 |
attaattttaggctaaaatatgtttttggtccctgc--aaatatagtgagtttgggttttggtccctg |
25977925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 132 - 190
Target Start/End: Complemental strand, 25979311 - 25979255
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
25979311 |
aggctaaaatatgtttttggtccctgc--aaatatagcgaatttgggttttggtccctg |
25979255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 84
Target Start/End: Complemental strand, 15018084 - 15018022
Alignment:
| Q |
22 |
tcggtacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgttaca |
84 |
Q |
| |
|
||||| |||||| |||||||||||||| |||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
15018084 |
tcggttcctttgtgtgttcgttttcgtaggttatttgagctttatgagaataaatatgttaca |
15018022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 133 - 190
Target Start/End: Complemental strand, 25283331 - 25283276
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
25283331 |
ggctaaaatatgtttttggtcactgcaaa--tatagcgaatttgagttttgatccctg |
25283276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 131 - 182
Target Start/End: Complemental strand, 2412489 - 2412440
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
2412489 |
taggctaaaatatgtttttggtccctgc--aaatatagcgagtttgggtttt |
2412440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 125 - 161
Target Start/End: Original strand, 15531021 - 15531057
Alignment:
| Q |
125 |
taattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15531021 |
taattttaggctaaaatatgtttttggtccctgcaaa |
15531057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 1777468 - 1777524
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||| |||||| |||||| |
|
|
| T |
1777468 |
aggctaaaatatgtttttggtccctgc--aaatatagcgagtttgagttttggtccctg |
1777524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 8809595 - 8809652
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccc-tgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
8809595 |
aggctaaaatatgtttttggtcccttgc--aaatataacgaatttgggttttggtccctg |
8809652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 190
Target Start/End: Complemental strand, 8810760 - 8810707
Alignment:
| Q |
135 |
ctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
8810760 |
ctaaaatatgtttttggtctctgc--aaatatagcgaatttggattttaatccctg |
8810707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 193
Target Start/End: Complemental strand, 29794378 - 29794318
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||| |||||| | ||||||| |
|
|
| T |
29794378 |
ttaggctaaaatatgtttt-ggtccctgcaaa--tatagcgaatttgagttttggttcctgata |
29794318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 135 - 189
Target Start/End: Complemental strand, 23863107 - 23863055
Alignment:
| Q |
135 |
ctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
||||||||||||||||||| |||| |||||| |||| ||||||||||||||||| |
|
|
| T |
23863107 |
ctaaaatatgtttttggtctctgc--aaatatggcgagtttgggttttgatccct |
23863055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 161
Target Start/End: Original strand, 23861750 - 23861780
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23861750 |
taggctaaaatatgtttttggtccctgcaaa |
23861780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 161
Target Start/End: Original strand, 24358610 - 24358644
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
24358610 |
attttaggctaaaatatggttttggtccctgcaaa |
24358644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 136 - 181
Target Start/End: Complemental strand, 24754214 - 24754171
Alignment:
| Q |
136 |
taaaatatgtttttggtccctgcaaaaatatagcgaatttgggttt |
181 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
24754214 |
taaaatatgtttttggtccctgc--aaatatggcgaatttgggttt |
24754171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 161
Target Start/End: Complemental strand, 2481570 - 2481529
Alignment:
| Q |
120 |
atcattaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
2481570 |
atcatttatttaaggctaaaatatggttttggtccctgcaaa |
2481529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 14003404 - 14003437
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
14003404 |
ttttaggctaaaatatggttttggtccctgcaaa |
14003437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 132
Target Start/End: Original strand, 17248001 - 17248034
Alignment:
| Q |
99 |
caattagaacacaattaacatatcattaatttta |
132 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
17248001 |
caattaaaacacaattaacatatcattaatttta |
17248034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 20131312 - 20131345
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
20131312 |
ttttaggctaaaatatggttttggtccctgcaaa |
20131345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 25705453 - 25705421
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
25705453 |
tttaggctaaaatatggttttggtccctgcaaa |
25705421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 190
Target Start/End: Complemental strand, 36837839 - 36837782
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||| |||||||| ||||||||| ||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
36837839 |
taggttaaaatatatttttggtctctgcaaa--tatagcgagtttgggttttggtccctg |
36837782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 19)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 84
Target Start/End: Original strand, 22094982 - 22095045
Alignment:
| Q |
21 |
ttcggtacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgttaca |
84 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22094982 |
ttcggtccctttttgtgttcgttttcgtaggttgtttgagctttatgaaaataaatatgttaca |
22095045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 3936577 - 3936633
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
3936577 |
aggctaaaatatgtttttggtccctgc--aaatatagcgagtttgggttttggtccctg |
3936633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 132 - 190
Target Start/End: Complemental strand, 27571189 - 27571133
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
27571189 |
aggctaaaatatgattttggtccctgcaaa--tatagcgagtttgggttttgatccctg |
27571133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 130 - 183
Target Start/End: Original strand, 31540493 - 31540544
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
31540493 |
ttaggctaaaatatgtttttggtccctgc--aaatataacgaatttgggttttg |
31540544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 130 - 190
Target Start/End: Original strand, 3954049 - 3954107
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
3954049 |
ttaggctaaaatatgtttttggtccttgc--aaatatatcgaatttgggttttggtccctg |
3954107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 190
Target Start/End: Original strand, 4565388 - 4565448
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||||||| |||||| | ||||||||||| ||||||||||| |||||| |
|
|
| T |
4565388 |
ttttaggctaaaatatgtttttagtccct--acaaatatagcgagtttgggttttggtccctg |
4565448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 189
Target Start/End: Complemental strand, 34911888 - 34911833
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
34911888 |
aggctaaaatatgattttggtccctgc--aaatatagcgagtttggattttgatccct |
34911833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 188
Target Start/End: Original strand, 15599762 - 15599818
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccc |
188 |
Q |
| |
|
||||||||||||||| ||||||||||| | |||||| |||||||||||||||| |||| |
|
|
| T |
15599762 |
ttaggctaaaatatgcttttggtccct--acaaatatggcgaatttgggttttggtccc |
15599818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 161
Target Start/End: Original strand, 5917116 - 5917154
Alignment:
| Q |
123 |
attaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
5917116 |
attaattataggctaaaatatggttttggtccctgcaaa |
5917154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 161
Target Start/End: Complemental strand, 19565837 - 19565803
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
19565837 |
attttaggctaaaatatggttttggtccctgcaaa |
19565803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 161
Target Start/End: Complemental strand, 35877058 - 35877024
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
35877058 |
attttaggctaaaatatggttttggtccctgcaaa |
35877024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 161
Target Start/End: Complemental strand, 29875738 - 29875697
Alignment:
| Q |
120 |
atcattaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||| ||||||||||||||||| |||| ||||||||||| |
|
|
| T |
29875738 |
atcattatttttaggctaaaatatggttttagtccctgcaaa |
29875697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Original strand, 1104854 - 1104886
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
1104854 |
tttaggctaaaatatggttttggtccctgcaaa |
1104886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 1105152 - 1105120
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
1105152 |
tttaggctaaaatatggttttggtccctgcaaa |
1105120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 161
Target Start/End: Complemental strand, 6118515 - 6118471
Alignment:
| Q |
117 |
catatcattaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||| ||||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
6118515 |
catataattaatttttggctaaaatatggttttagtccctgcaaa |
6118471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 190
Target Start/End: Complemental strand, 25254188 - 25254135
Alignment:
| Q |
135 |
ctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| || |||| ||||||||||||| |
|
|
| T |
25254188 |
ctaaaatatgcttttggtccctgcaaatatata--gagtttgagttttgatccctg |
25254135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 190
Target Start/End: Complemental strand, 25317978 - 25317925
Alignment:
| Q |
135 |
ctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| || |||| ||||||||||||| |
|
|
| T |
25317978 |
ctaaaatatgcttttggtccctgcaaatatata--gagtttgagttttgatccctg |
25317925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 161
Target Start/End: Complemental strand, 31037753 - 31037713
Alignment:
| Q |
121 |
tcattaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
31037753 |
tcattaaatttaggctaaaatatggttttagtccctgcaaa |
31037713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Original strand, 32108804 - 32108836
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
32108804 |
tttaggctaaaatatggttttggtccctgcaaa |
32108836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 24)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 503269 - 503327
Alignment:
| Q |
26 |
tacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgttaca |
84 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
503269 |
tacctttgtgtgttcgttttcgtaggttgtttgagctttttgaaaataaatatgttaca |
503327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 8264626 - 8264568
Alignment:
| Q |
26 |
tacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgttaca |
84 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
8264626 |
tacctttgtgtgttcgttttcgtaggttgtttgagctttttgaaaataaatatgttaca |
8264568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 129 - 182
Target Start/End: Original strand, 3276363 - 3276414
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3276363 |
tttaggctaaaatatgtttttggtccctgc--aaatatagcgaatttggatttt |
3276414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 130 - 190
Target Start/End: Original strand, 21953203 - 21953261
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
21953203 |
ttaggctaaaatatgcttttggtccctgc--aaatatagcgaatttggattttggtccctg |
21953261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 182
Target Start/End: Original strand, 1972395 - 1972447
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
1972395 |
tttttggctaaaatatgtttttggtccctgc--aaataaagcgaatttgggtttt |
1972447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 16995450 - 16995506
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||| |
|
|
| T |
16995450 |
aggctaaaatatgtttttggtccctgc--aaatataaagaatttgggttttggtccctg |
16995506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 17517373 - 17517313
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |||| |||||| |||||| |
|
|
| T |
17517373 |
ttttaggctaaaatatgtttttggtccctgc--aaatatggcgagtttgagttttggtccctg |
17517313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 5085767 - 5085821
Alignment:
| Q |
30 |
tttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgttaca |
84 |
Q |
| |
|
|||| |||| ||||||||| ||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
5085767 |
tttgtgtgtacgttttcgtaggttgtttgagctttatgagaataaatatgttaca |
5085821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 190
Target Start/End: Complemental strand, 20897556 - 20897501
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
20897556 |
ggctaaaatatggttttggtccctgc--aaatatagtgaatttgggttttggtccctg |
20897501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 133 - 193
Target Start/End: Complemental strand, 1974211 - 1974153
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
|||||||||||||||||| ||| |||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
1974211 |
ggctaaaatatgtttttgatccttgcaaa--tatagcgaatttgagttttggtccctgata |
1974153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 161
Target Start/End: Original strand, 6412209 - 6412246
Alignment:
| Q |
124 |
ttaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6412209 |
ttaattttaggctaaaatatggttttggtccctgcaaa |
6412246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 182
Target Start/End: Original strand, 20895960 - 20896005
Alignment:
| Q |
135 |
ctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
20895960 |
ctaaaatatgtttttggtccctgc--aaatatagcgaatttgagtttt |
20896005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 190
Target Start/End: Complemental strand, 34998202 - 34998145
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
34998202 |
taggctaaaatatgcttttgatccctgc--aaatatagcgagtttgggttttggtccctg |
34998145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 135 - 193
Target Start/End: Original strand, 17516164 - 17516220
Alignment:
| Q |
135 |
ctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | || ||||||||||| ||||||||| |
|
|
| T |
17516164 |
ctaaaatatgtttttggtccctgc--aaatatggtgagtttgggttttggtccctgata |
17516220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 190
Target Start/End: Original strand, 18810532 - 18810587
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| || ||||||||||| |||||| |
|
|
| T |
18810532 |
ggctaaaatatgattttggtccctgc--aaatatagtgagtttgggttttggtccctg |
18810587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 161
Target Start/End: Complemental strand, 19129526 - 19129492
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
19129526 |
attttaggctaaaatatgattttggtccctgcaaa |
19129492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 161
Target Start/End: Complemental strand, 19321137 - 19321103
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
19321137 |
attttaggctaaaatatggttttggtccctgcaaa |
19321103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 20391217 - 20391268
Alignment:
| Q |
136 |
taaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
||||||||| ||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
20391217 |
taaaatatgcttttggtccctgc--aaatatagtgaatttgggttttggtccct |
20391268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 190
Target Start/End: Original strand, 21165246 - 21165301
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| |||| |||||| |||||| |
|
|
| T |
21165246 |
ggctaaaatatgcttttggtccctgc--aaatatagcgagtttgtgttttggtccctg |
21165301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 1007119 - 1007152
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
1007119 |
ttttaggctaaaatatggttttggtccctgcaaa |
1007152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 181
Target Start/End: Complemental strand, 20393327 - 20393281
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttt |
181 |
Q |
| |
|
|||||||||||| ||||| |||||||||| |||||||||||||||||| |
|
|
| T |
20393327 |
ggctaaaatatgcttttgatccctgcaaa--tatagcgaatttgggttt |
20393281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 183
Target Start/End: Original strand, 34995112 - 34995162
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |||||||||||||||| |||||| |
|
|
| T |
34995112 |
taggctaaaatatgcttttgatccctgc--aaatatagcgaatttgagttttg |
34995162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 21994407 - 21994375
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
21994407 |
tttaggctaaaatatggttttggtccctgcaaa |
21994375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 22543722 - 22543690
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
22543722 |
tttaggctaaaatatggttttggtccctgcaaa |
22543690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 28)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 130 - 190
Target Start/End: Complemental strand, 31848206 - 31848148
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31848206 |
ttaggctaaaatatgtttttagtccctgc--aaatatagcgaatttgggttttggtccctg |
31848148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 24195606 - 24195662
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
24195606 |
aggctaaaatatgtttttggtccctgc--aaatatagcgagtttgggttttgctccctg |
24195662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 25924473 - 25924415
Alignment:
| Q |
26 |
tacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgttaca |
84 |
Q |
| |
|
|||||||| |||||| ||||||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
25924473 |
tacctttgtgtgttcattttcgtaggttgtttgagctttttgaaaataaatatgttaca |
25924415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 130 - 183
Target Start/End: Complemental strand, 32197971 - 32197920
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32197971 |
ttaggctaaaatatgcttttggtccctgc--aaatatagcgaatttgggttttg |
32197920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 193
Target Start/End: Original strand, 32196685 - 32196742
Alignment:
| Q |
134 |
gctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||| ||||| ||||||||| |
|
|
| T |
32196685 |
gctaaaatatgtttttggtccctgc--aaatatagcgtatttggattttggtccctgata |
32196742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 13418949 - 13419005
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||||| ||| |||||| |
|
|
| T |
13418949 |
aggctaaaatatgtttttggtccctgc--aaatattgcgaatttgggtattggtccctg |
13419005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 41693644 - 41693700
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
41693644 |
aggctaaaatatgtttttgatccctgc--aaatatggcgaatttgggttttggtccctg |
41693700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 129 - 182
Target Start/End: Complemental strand, 5611570 - 5611519
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
5611570 |
tttaggctaaaatatgattttggtccctgc--aaatatagcgagtttgggtttt |
5611519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 183
Target Start/End: Complemental strand, 24197164 - 24197114
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
24197164 |
taggctaaaatatgcttttggtccctgc--aaatatagcgaatttgagttttg |
24197114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 136 - 183
Target Start/End: Complemental strand, 32544830 - 32544785
Alignment:
| Q |
136 |
taaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32544830 |
taaaatatgattttggtccctgcaaa--tatagcgaatttgggttttg |
32544785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 190
Target Start/End: Original strand, 17066420 - 17066480
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||| |||| ||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
17066420 |
ttttaggctaaaatatgcttttaatccctgc--aaatatagcgagtttgggttttggtccctg |
17066480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 35212067 - 35212123
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||| ||||||||||| |||||| |
|
|
| T |
35212067 |
aggctaaaatatgtttttggtccctgc--aaatatgacgagtttgggttttggtccctg |
35212123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 161
Target Start/End: Complemental strand, 35838348 - 35838309
Alignment:
| Q |
122 |
cattaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
35838348 |
cattatttttaggctaaaatatggttttggtccctgcaaa |
35838309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 161
Target Start/End: Complemental strand, 12932785 - 12932755
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12932785 |
taggctaaaatatgtttttggtccctgcaaa |
12932755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 161
Target Start/End: Original strand, 25988379 - 25988413
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
25988379 |
attttaggctaaaatatggttttggtccctgcaaa |
25988413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Complemental strand, 31489993 - 31489946
Alignment:
| Q |
134 |
gctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
31489993 |
gctaaaatatgtttttggtccctgc--aaatataacgagtttgggttttg |
31489946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 190
Target Start/End: Complemental strand, 41695018 - 41694959
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||| |||| |||||| |||||| |
|
|
| T |
41695018 |
tttaggctaaaatatgtttttcatccctgc--aaatatagcgagtttgagttttggtccctg |
41694959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 164
Target Start/End: Complemental strand, 6892262 - 6892229
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaat |
164 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
6892262 |
taggctaaaatatggttttggtccctgcaaaaat |
6892229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Complemental strand, 11767280 - 11767247
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
11767280 |
ttttaggctaaaatatggttttggtccctgcaaa |
11767247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 23399607 - 23399640
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
23399607 |
ttttaggctaaaatatggttttggtccctgcaaa |
23399640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 36748193 - 36748226
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
36748193 |
tttttggctaaaatatgtttttggtccctgcaaa |
36748226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 38742184 - 38742234
Alignment:
| Q |
136 |
taaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccc |
188 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
38742184 |
taaaatatgtttttagtccctgc--aaatatagcgagtttgggttttggtccc |
38742234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Complemental strand, 41054241 - 41054208
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
41054241 |
ttttaggctaaaatatggttttggtccctgcaaa |
41054208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 46759653 - 46759686
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
46759653 |
ttttaggctaaaatatggttttggtccctgcaaa |
46759686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 3975842 - 3975810
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
3975842 |
tttaggctaaaatatggttttggtccctgcaaa |
3975810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 162
Target Start/End: Complemental strand, 27037905 - 27037873
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaa |
162 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
27037905 |
ttaggctaaaatatggttttggtccctgcaaaa |
27037873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 190
Target Start/End: Complemental strand, 28462685 - 28462632
Alignment:
| Q |
135 |
ctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
28462685 |
ctaaaatatgcttttggtctctgcaaa--tatgacgaatttgggttttgatccctg |
28462632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 190
Target Start/End: Complemental strand, 43869965 - 43869916
Alignment:
| Q |
139 |
aatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||||||||| |||||| |
|
|
| T |
43869965 |
aatatggttttggtccctgcaaa--tatagccaatttgggttttggtccctg |
43869916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 34)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 126 - 190
Target Start/End: Original strand, 35721094 - 35721156
Alignment:
| Q |
126 |
aattttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
35721094 |
aattataggctaaaatatgtttttggtccctgc--aaatataacgaatttgggttttggtccctg |
35721156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 37395632 - 37395688
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
37395632 |
aggctaaaatatgtttttggtccctgc--aaatatagcgtatttgggttttggtccctg |
37395688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 135 - 193
Target Start/End: Original strand, 51240121 - 51240177
Alignment:
| Q |
135 |
ctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
51240121 |
ctaaaatatgtttttggtctctgcaaa--tatagcgaatttggattttgatccctgata |
51240177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 133 - 190
Target Start/End: Complemental strand, 23470028 - 23469973
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
23470028 |
ggctaaaatatgtttttggtccctgc--aaatatagcgagtttcggttttgatccctg |
23469973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 25504730 - 25504788
Alignment:
| Q |
26 |
tacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgttaca |
84 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
25504730 |
tacctttgtgtgttcgtttccgtaggttgtttgagctttttgaaaataaatatgttaca |
25504788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 121 - 190
Target Start/End: Complemental strand, 27264287 - 27264220
Alignment:
| Q |
121 |
tcattaattttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
27264287 |
tcattatttataggctaaaatatgattttggtccctgc--aaatatagcgagtttgggttttggtccctg |
27264220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 132 - 193
Target Start/End: Complemental strand, 48594108 - 48594049
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
48594108 |
aggctaaaatatgtttttggtccctg--taaatatggcgagtttgggttttgatccctgata |
48594049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 132 - 193
Target Start/End: Complemental strand, 48598719 - 48598660
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
48598719 |
aggctaaaatatgtttttggtccctg--taaatatggcgagtttgggttttgatccctgata |
48598660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 133 - 181
Target Start/End: Complemental strand, 11711312 - 11711266
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttt |
181 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11711312 |
ggctaaaatatgtttttggtccctgc--aaatatagcgaatttgggttt |
11711266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 127 - 190
Target Start/End: Original strand, 26863854 - 26863915
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
26863854 |
atttaaggctaaaatgtgtttttggtccctgc--aaatatagcgaatttgagttttggtccctg |
26863915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 132 - 183
Target Start/End: Complemental strand, 45979556 - 45979507
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
45979556 |
aggctaaaatatgtttttggtccctgc--aaatatagcgaatttgagttttg |
45979507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 190
Target Start/End: Complemental strand, 9774948 - 9774892
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
9774948 |
aggctaaaatatgcttttggtccctgc--aaatatagcgagtttgggttttggtccctg |
9774892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 182
Target Start/End: Complemental strand, 20723748 - 20723700
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
20723748 |
aggctaaaatatgtttttggtccctgc--aaatatagcgaatttgagtttt |
20723700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 27262907 - 27262963
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||| |||||| |||||| |
|
|
| T |
27262907 |
aggctaaaatatgtttttggtccctgc--aaatatagcgagtttgtgttttggtccctg |
27262963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 183
Target Start/End: Complemental strand, 34934810 - 34934758
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34934810 |
tttaggctaaaatatgctttttgtccctgc--aaatatagcgaatttgggttttg |
34934758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 183
Target Start/End: Complemental strand, 35722348 - 35722296
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35722348 |
tttaggctaaaatatgtttttggtccctg--taaatatagcgaatttggattttg |
35722296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 190
Target Start/End: Original strand, 20722472 - 20722527
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
20722472 |
ggctaaaatgtgcttttggtccctgcaaa--tatagcgaatttgggttttggtccctg |
20722527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 190
Target Start/End: Complemental strand, 46075109 - 46075054
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
46075109 |
ggctaaaatatgtttttgatccctgc--aaatatagcgagtttgggttttggtccctg |
46075054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 133 - 189
Target Start/End: Original strand, 24609919 - 24609973
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||| ||||||||||| ||||| |
|
|
| T |
24609919 |
ggctaaaatatgtttttggtccctgc--aaatatggcgagtttgggttttggtccct |
24609973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 183
Target Start/End: Complemental strand, 17977619 - 17977570
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||| ||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17977619 |
aggcttaaatatggttttggtccctgcaaa--tatagcgaatttgggttttg |
17977570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 183
Target Start/End: Complemental strand, 35911948 - 35911899
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35911948 |
aggctaaaatatgcttttggtccctgc--aaatatagcgaatttggattttg |
35911899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 186
Target Start/End: Complemental strand, 2604191 - 2604135
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatc |
186 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||| | || |||||||||||||| |
|
|
| T |
2604191 |
ttttaggctaaaatatgtttttagtccctgc--aaatatggggagtttgggttttgatc |
2604135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 161
Target Start/End: Original strand, 15516571 - 15516610
Alignment:
| Q |
122 |
cattaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
15516571 |
cattgattttaggctaaaatatggttttggtccctgcaaa |
15516610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 183
Target Start/End: Complemental strand, 37396899 - 37396851
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
37396899 |
ggctaaaatatgcttttggtccctgc--aaatatagcgaatttgagttttg |
37396851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 47038865 - 47038921
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||| | ||||||||||| |||||| |
|
|
| T |
47038865 |
aggctaaaatatgtttttagtccctgc--aaatatagctagtttgggttttggtccctg |
47038921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 131 - 193
Target Start/End: Complemental strand, 48334193 - 48334133
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
|||||||||||||| ||||||||||| | |||||||||||||||| |||||| | ||||||| |
|
|
| T |
48334193 |
taggctaaaatatgcttttggtccct--acaaatatagcgaatttgagttttggttcctgata |
48334133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 190
Target Start/End: Original strand, 17976761 - 17976816
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||| ||||||| ||||||| |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
17976761 |
ggcttaaatatggttttggttcctgcaaa--tatagcgaatttgggttttggtccctg |
17976816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 190
Target Start/End: Complemental strand, 39163087 - 39163028
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||| |||| |||||||||| |||||| |
|
|
| T |
39163087 |
tttaggctaaaatatgcttttggtccctgc--aaatatggcgaggttgggttttggtccctg |
39163028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 193
Target Start/End: Complemental strand, 48589021 - 48588962
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | || ||||||||||| ||||||||| |
|
|
| T |
48589021 |
aggctaaaatatgtttttggtccctg--taaatatggtgagtttgggttttggtccctgata |
48588962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 10887228 - 10887261
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
10887228 |
ttttaggctaaaatatggttttggtccctgcaaa |
10887261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 190
Target Start/End: Complemental strand, 27816774 - 27816724
Alignment:
| Q |
138 |
aaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||| |||||||||||||||| |||||| ||||||||||||| |||||| |
|
|
| T |
27816774 |
aaatatggttttggtccctgcaaa--tatagccaatttgggttttggtccctg |
27816724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 30323297 - 30323265
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
30323297 |
tttaggctaaaatatgattttggtccctgcaaa |
30323265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Original strand, 45380268 - 45380300
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
45380268 |
tttaggctaaaatatggttttggtccctgcaaa |
45380300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 182
Target Start/End: Original strand, 46073883 - 46073932
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
46073883 |
taggctaaaatatgcttttgatccctgc--aaatatagcaaatttgggtttt |
46073932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 26)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 126 - 193
Target Start/End: Original strand, 3483626 - 3483691
Alignment:
| Q |
126 |
aattttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||| |||| |||||| ||||||||| |
|
|
| T |
3483626 |
aattttagactaaaatatgtttttggtccctgc--aaatatagcgagtttgagttttggtccctgata |
3483691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 190
Target Start/End: Original strand, 10717115 - 10717176
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
10717115 |
attttaggctaaaatatgcttttggtccctgc--aaatatagcgagtttgggttttggtccctg |
10717176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 189
Target Start/End: Complemental strand, 28998057 - 28997998
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
28998057 |
tttttggctaaaatatgtttttggtccctgc--aaatatagcgagtttgggttttggtccct |
28997998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 193
Target Start/End: Complemental strand, 41847251 - 41847181
Alignment:
| Q |
121 |
tcattaattttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
||||| |||||||||||||||||| |||| ||| ||||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
41847251 |
tcattcattttaggctaaaatatgcttttagtctctgcaaa--tatagcgaatttgagttttggtccctgata |
41847181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 131 - 190
Target Start/End: Complemental strand, 10718509 - 10718452
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
10718509 |
taggctaaaatatgcttttggtccctgc--aaatatagcgagtttgggttttggtccctg |
10718452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 127 - 190
Target Start/End: Original strand, 38658475 - 38658536
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||| || |||||| |||||| |||||||||||||||||||| |||||| |
|
|
| T |
38658475 |
attttaggctaaaatatgcttctggtccatgcaaa--tatagcgaatttgggttttggtccctg |
38658536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 81
Target Start/End: Original strand, 4987798 - 4987857
Alignment:
| Q |
22 |
tcggtacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgtt |
81 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||||||||||||| ||| ||||||| |||| |
|
|
| T |
4987798 |
tcggtacctttgtgtgttcgtttccgtaggttgtttgagctttttgataataaatatgtt |
4987857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 190
Target Start/End: Complemental strand, 22272330 - 22272274
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||| |||||||||| ||||| |||||||||||||||||||| |||||| |
|
|
| T |
22272330 |
aggctaaaatatgcttttggtccccgcaaa--tatagcgaatttgggttttggtccctg |
22272274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 193
Target Start/End: Original strand, 10292815 - 10292874
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
||||||||||||| ||||||||||| |||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
10292815 |
aggctaaaatatgattttggtcccttcaaa--tatagcgaatttgcgttttgatccttgata |
10292874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 123 - 161
Target Start/End: Complemental strand, 28346768 - 28346730
Alignment:
| Q |
123 |
attaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28346768 |
attaattttaggctaaaatatggttttggtccctgcaaa |
28346730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 133 - 193
Target Start/End: Complemental strand, 1420501 - 1420443
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||| | ||| ||||||||| |
|
|
| T |
1420501 |
ggctaaaatatgtttttggtccctgc--aaatatagcgagtttggatattggtccctgata |
1420443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 190
Target Start/End: Original strand, 4182623 - 4182677
Alignment:
| Q |
134 |
gctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||| |||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
4182623 |
gctaaaatatgcttttggtccctgtaaa--tatagcgaatttgggttttggtccctg |
4182677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 11019866 - 11019829
Alignment:
| Q |
124 |
ttaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11019866 |
ttaattttaggctaaaatatggttttggtccctgcaaa |
11019829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 190
Target Start/End: Complemental strand, 38456791 - 38456734
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| ||||| ||||||| |||||| |
|
|
| T |
38456791 |
taggctaaaatatgcttttggtccctgc--aaatatagcaaatttaggttttggtccctg |
38456734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 190
Target Start/End: Complemental strand, 45518021 - 45517964
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||| ||||||||||||| || |||||||| ||||||||||| |||||| |
|
|
| T |
45518021 |
taggctaaaatatgcttttggtccctgc--aagtatagcgagtttgggttttggtccctg |
45517964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 190
Target Start/End: Complemental strand, 22534782 - 22534726
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||| ||||| |||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
22534782 |
aggctaaaatatgcttttgatccctgcaaa--tatagcgagtttgggttttggtccctg |
22534726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 182
Target Start/End: Original strand, 30123151 - 30123199
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
||||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
30123151 |
aggctaaaatatgtttttggtccat--acaaatatagcgaatttgggtttt |
30123199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 36588221 - 36588277
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||| |||| |||||| |||||| |
|
|
| T |
36588221 |
aggctaaaatatgcttttggtccctgc--aaatatagcgagtttgcgttttggtccctg |
36588277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 189
Target Start/End: Original strand, 14197824 - 14197879
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||| ||||| ||||| ||||| |
|
|
| T |
14197824 |
aggctaaaatatgtttttggtccctgc--aaatatggcgagtttggattttggtccct |
14197879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 10337114 - 10337147
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
10337114 |
ttttaggctaaaatatggttttggtccctgcaaa |
10337147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 190
Target Start/End: Original strand, 28996835 - 28996889
Alignment:
| Q |
134 |
gctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| || ||||||||||| |||||| |
|
|
| T |
28996835 |
gctaaaatatgattttggtccctgc--aaatatagtgagtttgggttttggtccctg |
28996889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 190
Target Start/End: Original strand, 1376933 - 1376990
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||| ||||||| ||||||||||||| ||||||||| ||||||| ||||| |||||| |
|
|
| T |
1376933 |
taggcttaaatatgattttggtccctgc--aaatatagccaatttggattttggtccctg |
1376990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 190
Target Start/End: Complemental strand, 1385616 - 1385559
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||| ||||||| ||||||||||||| ||||||||| ||||||| ||||| |||||| |
|
|
| T |
1385616 |
taggcttaaatatggttttggtccctgc--aaatatagccaatttggattttggtccctg |
1385559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 3512270 - 3512238
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
3512270 |
tttaggctaaaatatggttttggtccctgcaaa |
3512238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 182
Target Start/End: Original strand, 22270941 - 22270990
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
22270941 |
taggctaaaatatgcttttgatccctgc--aaatatagcgaatttggatttt |
22270990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 30124286 - 30124254
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
30124286 |
tttaggctaaaatatgcttttggtccctgcaaa |
30124254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 30)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 8935476 - 8935420
Alignment:
| Q |
26 |
tacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgtta |
82 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| ||||||||||| ||||| |
|
|
| T |
8935476 |
tacctttgtgtgttcgttttcgtaggttgtttgagctttttgaaaataaatatgtta |
8935420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 84
Target Start/End: Complemental strand, 19114843 - 19114781
Alignment:
| Q |
22 |
tcggtacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgttaca |
84 |
Q |
| |
|
||||| |||||| |||||||||||||| |||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
19114843 |
tcggttcctttgtgtgttcgttttcgtaggttatttgagctttatgagaataaatatgttaca |
19114781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 49926003 - 49926061
Alignment:
| Q |
26 |
tacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgttaca |
84 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
49926003 |
tacctttgtgtgttcgtttccgtaggttgtttgagctttttgaaaataaatatgttaca |
49926061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 81
Target Start/End: Complemental strand, 19648116 - 19648057
Alignment:
| Q |
22 |
tcggtacctttgagtgttcgttttcgtgggttgtttgagctttatgaaaataaatctgtt |
81 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||||||||||||| ||| ||||||| |||| |
|
|
| T |
19648116 |
tcggtacctttgtgtgttcgtttccgtaggttgtttgagctttttgataataaatatgtt |
19648057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 42359410 - 42359350
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||| ||||| ||||| |||||| |
|
|
| T |
42359410 |
tttttggctaaaatatgtttttggtccctgc--aaatatagcgagtttggattttggtccctg |
42359350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 45619795 - 45619735
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||| ||| ||||||| |||||| |
|
|
| T |
45619795 |
ttttaggctaaaatatgtttttagtccctgc--aaatatagcgagtttaggttttgttccctg |
45619735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 132 - 189
Target Start/End: Complemental strand, 3880556 - 3880501
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
3880556 |
aggctaaaatatgtttttggttcctgc--aaatatagcgagtttgggttttggtccct |
3880501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 182
Target Start/End: Original strand, 22204055 - 22204102
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
22204055 |
ggctaaaatatgtttttggtccctgc--aaatatagcgagtttgggtttt |
22204102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 133 - 189
Target Start/End: Complemental strand, 32699373 - 32699319
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
32699373 |
ggctaaaatatgtttttggtccctg--taaatatagcgagtttgggttttggtccct |
32699319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 190
Target Start/End: Original strand, 45618283 - 45618340
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||| ||||| ||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
45618283 |
taggctaatatatgcttttggtccctgc--aaatatagcgagtttgggttttggtccctg |
45618340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 190
Target Start/End: Original strand, 3879081 - 3879141
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| ||||||||||| ||||| ||||| |||||| |
|
|
| T |
3879081 |
ttttaggctaaaatatgcttttgatccctgc--aaatatagcgagtttggattttggtccctg |
3879141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 182
Target Start/End: Complemental strand, 33137288 - 33137240
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
33137288 |
aggctaaaatatgtttttgatccctgc--aaatatagcgagtttgggtttt |
33137240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 42358031 - 42358087
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| | |||| ||||||||||||| |
|
|
| T |
42358031 |
aggctaaaatatgtttttggtccctgc--aaatataggaagtttgagttttgatccctg |
42358087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 161
Target Start/End: Original strand, 42823769 - 42823804
Alignment:
| Q |
126 |
aattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42823769 |
aattttaggctaaaatatgattttggtccctgcaaa |
42823804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 44705299 - 44705347
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
44705299 |
ggctaaaatatgtttttggtctctgc--aaatatagtgaatttgggttttg |
44705347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 161
Target Start/End: Complemental strand, 13074131 - 13074097
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
13074131 |
attttaggctaaaatatggttttggtccctgcaaa |
13074097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 190
Target Start/End: Original strand, 19674410 - 19674469
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| ||||||||||| |||| |||||| |||||| |
|
|
| T |
19674410 |
tttaggctaaaatatgcttttggtccttgc--aaatatagcgagtttgagttttggtccctg |
19674469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 84
Target Start/End: Complemental strand, 23657774 - 23657740
Alignment:
| Q |
50 |
ggttgtttgagctttatgaaaataaatctgttaca |
84 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
23657774 |
ggttgtttgagctttatgaaaataaatcagttaca |
23657740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 161
Target Start/End: Complemental strand, 5259211 - 5259182
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5259211 |
aggctaaaatatgtttttggtccctgcaaa |
5259182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 14594201 - 14594234
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
14594201 |
ttttaggctaaaatatggttttggtccctgcaaa |
14594234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 193
Target Start/End: Complemental strand, 19675679 - 19675621
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| ||| ||||| ||||| ||||||||| |
|
|
| T |
19675679 |
ggctaaaatatgcttttggtccctgc--aaatataacgagtttggattttggtccctgata |
19675621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 183
Target Start/End: Original strand, 35054660 - 35054710
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
35054660 |
taggttaaaatatgattttagtccctgcaaa--tatagcgaatttgggttttg |
35054710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 35464013 - 35464046
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
35464013 |
ttttaggctaaaatatggttttggtccctgcaaa |
35464046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 183
Target Start/End: Original strand, 41933816 - 41933866
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
41933816 |
taggctaaaatatgattttggtctctgc--aaatatagcgagtttgggttttg |
41933866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Original strand, 13631224 - 13631256
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
13631224 |
tttaggctaaaatatggttttggtccctgcaaa |
13631256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 14488191 - 14488159
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
14488191 |
tttaggctaaaatatggttttggtccctgcaaa |
14488159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 183
Target Start/End: Complemental strand, 34660988 - 34660933
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
|||| |||||||||||||||||| ||| ||||||| |||||| |||||| ||||||| |
|
|
| T |
34660988 |
atttaaggctaaaatatgttttt-gtctctgcaaatatatagggaatttaggttttg |
34660933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 164
Target Start/End: Original strand, 41324768 - 41324800
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaat |
164 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
41324768 |
aggctaaaatatggttttggtccctgcaaaaat |
41324800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 183
Target Start/End: Complemental strand, 41935126 - 41935081
Alignment:
| Q |
136 |
taaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
41935126 |
taaaatatgtttttggtccctgc--aaatataacgagtttgggttttg |
41935081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 167
Target Start/End: Complemental strand, 50754266 - 50754222
Alignment:
| Q |
123 |
attaattttaggctaaaatatgtttttggtccctgcaaaaatata |
167 |
Q |
| |
|
|||||||||||||||||||||| ||||| || ||||||| ||||| |
|
|
| T |
50754266 |
attaattttaggctaaaatatggttttgatcactgcaaacatata |
50754222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 26)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 182
Target Start/End: Original strand, 53121292 - 53121349
Alignment:
| Q |
123 |
attaattttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggtttt |
182 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
53121292 |
attaatttaaggctaaaatatgtttttggtccctgc--aaatatagcgagtttgggtttt |
53121349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 190
Target Start/End: Complemental strand, 52403192 - 52403128
Alignment:
| Q |
124 |
ttaattttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||| |||| ||||||||||| |||||| |
|
|
| T |
52403192 |
ttaattttaggctaaaatatgcttttggtccctgc--aaatatggcgagtttgggttttggtccctg |
52403128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 131 - 189
Target Start/End: Complemental strand, 54437528 - 54437472
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||| ||||| |
|
|
| T |
54437528 |
taggctaaaatatgtttttggtccctgc--aaatatagcgaatttgagttttggtccct |
54437472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 122 - 191
Target Start/End: Complemental strand, 20585714 - 20585647
Alignment:
| Q |
122 |
cattaattttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctga |
191 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| ||||||||||| ||||| ||||| ||||||| |
|
|
| T |
20585714 |
cattatttttaggctaaaatatgtttttgatccctgc--aaatatagcgagtttggattttggtccctga |
20585647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 189
Target Start/End: Original strand, 46026071 - 46026130
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||| ||||| |
|
|
| T |
46026071 |
ttttaggctaaaatatgtttttggtccctgc--aaatatagcgagtttggattttggtccct |
46026130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 130 - 190
Target Start/End: Complemental strand, 47433871 - 47433813
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
47433871 |
ttaggctaaaatatggttttggtccctgc--aaatatagcgaatttgagttttggtccctg |
47433813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 131 - 190
Target Start/End: Complemental strand, 39820665 - 39820608
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
39820665 |
taggctaaaatatggttttggtccctgc--aaatatagcgagtttgggttttggtccctg |
39820608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 130 - 193
Target Start/End: Original strand, 52707533 - 52707594
Alignment:
| Q |
130 |
ttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctgata |
193 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
52707533 |
ttaggttaaaatatgtttttggtccttgcaaa--tatagcgaatttgagttttggtccctgata |
52707594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 52401016 - 52401072
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||| ||||||||||| |||||| |
|
|
| T |
52401016 |
aggctaaaatatgtttttggtccctgc--aaatatggcgagtttgggttttggtccctg |
52401072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 190
Target Start/End: Original strand, 20488368 - 20488421
Alignment:
| Q |
135 |
ctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | |||||||||||||| |||||| |
|
|
| T |
20488368 |
ctaaaatatgtttttggtccctgc--aaatatggtgaatttgggttttggtccctg |
20488421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 45268634 - 45268574
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| | ||||||||||| |||||| |
|
|
| T |
45268634 |
ttttaggctaaaatatgtttttaatccctgc--aaatatagcaagtttgggttttggtccctg |
45268574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 161
Target Start/End: Original strand, 52342188 - 52342223
Alignment:
| Q |
126 |
aattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52342188 |
aattttaggctaaaatatggttttggtccctgcaaa |
52342223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 183
Target Start/End: Complemental strand, 52708676 - 52708628
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
52708676 |
ggctaaaatatgcttttggtccctgc--aaatatagcgagtttgggttttg |
52708628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 161
Target Start/End: Original strand, 26089716 - 26089758
Alignment:
| Q |
119 |
tatcattaattttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||| ||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
26089716 |
tatcaataatttttggctaaaatatggttttggtccctgcaaa |
26089758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 161
Target Start/End: Original strand, 30128278 - 30128312
Alignment:
| Q |
127 |
attttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
30128278 |
attttaggctaaaatatggttttggtccctgcaaa |
30128312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 40476222 - 40476269
Alignment:
| Q |
134 |
gctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
40476222 |
gctaaaatatgtttttggtccctgc--aaatatagcgagtttggattttg |
40476269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 189
Target Start/End: Complemental strand, 40477434 - 40477379
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| ||| ||||||||||| ||||| |
|
|
| T |
40477434 |
aggctaaaatatgattttggtccctgc--aaatataacgagtttgggttttggtccct |
40477379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 157
Target Start/End: Original strand, 50998874 - 50998908
Alignment:
| Q |
123 |
attaattttaggctaaaatatgtttttggtccctg |
157 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50998874 |
attaatttttggctaaaatatgtttttggtccctg |
50998908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 12740902 - 12740935
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
12740902 |
ttttaggctaaaatatggttttggtccctgcaaa |
12740935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 190
Target Start/End: Complemental strand, 20489416 - 20489362
Alignment:
| Q |
134 |
gctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||| ||||||||||| |||||| |
|
|
| T |
20489416 |
gctaaaatatgtttttggtccctgc--aaatatgacgagtttgggttttggtccctg |
20489362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Complemental strand, 39132911 - 39132878
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
39132911 |
ttttaggctaaaatatggttttggtccctgcaaa |
39132878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 40545559 - 40545592
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
40545559 |
ttttaggctaaaatatggttttggtccctgcaaa |
40545592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 183
Target Start/End: Original strand, 42446524 - 42446574
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
42446524 |
taggctaaaatatgcttttggtccctgc--aaatatggcgagtttgggttttg |
42446574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 190
Target Start/End: Original strand, 45267306 - 45267360
Alignment:
| Q |
134 |
gctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||| |||||| |||||| |
|
|
| T |
45267306 |
gctaaaatatgtttttgatccctgc--aaatatagcgagtttgagttttggtccctg |
45267360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Complemental strand, 47005524 - 47005491
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
47005524 |
ttttaggctaaaatatggttttggtccctgcaaa |
47005491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Complemental strand, 51550451 - 51550418
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
51550451 |
ttttaggctaaaatatggttttggtccctgcaaa |
51550418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 132 - 190
Target Start/End: Complemental strand, 11582 - 11526
Alignment:
| Q |
132 |
aggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
11582 |
aggctaaaatatgtttttggtccctgc--aaatatagcgtatttgggttttggtccctg |
11526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 10315 - 10363
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttg |
183 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
10315 |
ggctaaaatatgcttttggtccctgc--aaatatagcgaatttgagttttg |
10363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 190
Target Start/End: Original strand, 119593 - 119648
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
119593 |
ggctaaaatatgcttttggtccctgc--aaatatagcgaatttgagttttggtccctg |
119648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 190
Target Start/End: Complemental strand, 121044 - 120989
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| ||| ||||||||||| |||||| |
|
|
| T |
121044 |
ggctaaaatatgcttttggtccctgc--aaatataacgagtttgggttttggtccctg |
120989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 190
Target Start/End: Complemental strand, 30968 - 30911
Alignment:
| Q |
131 |
taggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| || ||||||||||| |||||| |
|
|
| T |
30968 |
taggctaaaatatggttttggtccctgc--aaatatagtgagtttgggttttggtccctg |
30911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 128 - 190
Target Start/End: Original strand, 9917 - 9977
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| ||||||||||| ||||| ||||| |||||| |
|
|
| T |
9917 |
ttttaggctaaaatatgcttttgatccctgc--aaatatagcgagtttggattttggtccctg |
9977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0765 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0765
Description:
Target: scaffold0765; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 1863 - 1914
Alignment:
| Q |
136 |
taaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccct |
189 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
1863 |
taaaatatgattttggtccctgc--aaatatagcgagtttgagttttgatccct |
1914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 190
Target Start/End: Complemental strand, 490 - 435
Alignment:
| Q |
133 |
ggctaaaatatgtttttggtccctgcaaaaatatagcgaatttgggttttgatccctg |
190 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| || ||||||||||| |||||| |
|
|
| T |
490 |
ggctaaaatatgattttggtccctgc--aaatatagtgagtttgggttttggtccctg |
435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Complemental strand, 2665 - 2632
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
2665 |
ttttaggctaaaatatggttttggtccctgcaaa |
2632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 161
Target Start/End: Complemental strand, 223177 - 223144
Alignment:
| Q |
128 |
ttttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
223177 |
ttttaggctaaaatatggttttggtccctgcaaa |
223144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 27368 - 27336
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
27368 |
tttaggctaaaatatggttttggtccctgcaaa |
27336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 161
Target Start/End: Complemental strand, 75768 - 75736
Alignment:
| Q |
129 |
tttaggctaaaatatgtttttggtccctgcaaa |
161 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
75768 |
tttaggctaaaatatggttttggtccctgcaaa |
75736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University