View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10194_low_27 (Length: 236)
Name: NF10194_low_27
Description: NF10194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10194_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 14178534 - 14178333
Alignment:
| Q |
16 |
gacatcagacaaatcaaacacctttgcaatgcaagagatctaaaatgaaattaagagtatatcaatacaagtcaatggcaactctcttttaatcgaaagg |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14178534 |
gacatcagacaaatcaaacacctctgcaatgtaagagatctaaaatgaaattaagagtatatcaatacaagtcagtggcaactctcttttaatcgaaagg |
14178435 |
T |
|
| Q |
116 |
tctcataaagatcggttgtatagatgattcaagttgaactaacactcaaaattctaaagagttataaaatttaatgtaaccctaaaataatttccatttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14178434 |
tctcataaagatcggttgtatagatgattcaagttgaactaacactcaaaattctaaggagttataaaatttaatgtaaccctaaaataatttccatttg |
14178335 |
T |
|
| Q |
216 |
ac |
217 |
Q |
| |
|
|| |
|
|
| T |
14178334 |
ac |
14178333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University