View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10194_low_30 (Length: 229)
Name: NF10194_low_30
Description: NF10194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10194_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 14348330 - 14348113
Alignment:
| Q |
7 |
ccaaaattactaattttttcgatgatattaaatatcctagcttattaagagattaaaatgagtattttattgcgatgaactaatttgggttctggctttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14348330 |
ccaaaattactaattttttcgatgatattaaatatcctagcttattaagagattaaaatgagtattttattgcgatgaactaatttgggttctggctttg |
14348231 |
T |
 |
| Q |
107 |
tttttcgatgaaatcaaatttttatgtcagataaattttgaatgtttcttaaacatattaaactttgttgaaccaaggatttttggaagtcgcattcttt |
206 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14348230 |
tttttcgatgaaatcaaatgtttatgtc-gataaattttgaatgtttcttaaacatattaaactttgttgaaccaaggatttttggaagtcgcattcttt |
14348132 |
T |
 |
| Q |
207 |
tccattattctttggcaaaatc |
228 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
14348131 |
tcc---attctttggcaaaatc |
14348113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University