View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10194_low_33 (Length: 224)

Name: NF10194_low_33
Description: NF10194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10194_low_33
NF10194_low_33
[»] chr1 (2 HSPs)
chr1 (13-76)||(49907885-49907948)
chr1 (142-206)||(49908014-49908078)


Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 13 - 76
Target Start/End: Original strand, 49907885 - 49907948
Alignment:
13 gatgaaaagaagggtcacgtaaatagatacaagaaaataagttttctcaaatgaaatcttctca 76  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49907885 gatgaaaagaagggtcacgtaaatagatacaagaaaataagttttctcaaatgaaatcttctca 49907948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 142 - 206
Target Start/End: Original strand, 49908014 - 49908078
Alignment:
142 aatagaaataattcactcttaatattgtgactgatgatgtataaatgaaaactgatccattcaat 206  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49908014 aatagaaagaattcactcttaatattgtgactgatgatgtataaatgaaaactgatccattcaat 49908078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University