View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10194_low_33 (Length: 224)
Name: NF10194_low_33
Description: NF10194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10194_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 13 - 76
Target Start/End: Original strand, 49907885 - 49907948
Alignment:
| Q |
13 |
gatgaaaagaagggtcacgtaaatagatacaagaaaataagttttctcaaatgaaatcttctca |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49907885 |
gatgaaaagaagggtcacgtaaatagatacaagaaaataagttttctcaaatgaaatcttctca |
49907948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 142 - 206
Target Start/End: Original strand, 49908014 - 49908078
Alignment:
| Q |
142 |
aatagaaataattcactcttaatattgtgactgatgatgtataaatgaaaactgatccattcaat |
206 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49908014 |
aatagaaagaattcactcttaatattgtgactgatgatgtataaatgaaaactgatccattcaat |
49908078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University