View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10194_low_35 (Length: 216)
Name: NF10194_low_35
Description: NF10194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10194_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 15 - 198
Target Start/End: Original strand, 30403747 - 30403931
Alignment:
| Q |
15 |
aagaatgttaaggaggaggttag-gagggttatcttttggttactttctttgaaggccatcacattgtttcccccaaaatataattttggcatattgcag |
113 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30403747 |
aagaatgttaaggaggaggttagtgagggttatcttttggttactttctttgaaggccatcacattgtttcccccaaaatataattttggaatattgcag |
30403846 |
T |
|
| Q |
114 |
atgattgtgcctgacaaaagggtgcttgtgcatgttgtatttctgatgttgatattctaacagacgtttaaatatattacgagtt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
30403847 |
atgattgtgcctgacaaaagggtgcttgtgcatgttgtatttcagatgttgatattctaacagatgtttaaatatattatgagtt |
30403931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University