View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10194_low_36 (Length: 201)

Name: NF10194_low_36
Description: NF10194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10194_low_36
NF10194_low_36
[»] chr2 (1 HSPs)
chr2 (17-188)||(41732859-41733030)


Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 41733030 - 41732859
Alignment:
17 ataagccccctgcaaaatgcagggtaaggctgcatacaatagattagtaatgggtccaatccaatcgtttcctagatcctactatgacgggagcttaata 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41733030 ataagccccctgcaaaatgcagggtaaggctgcatacaatagattagtaatgggtccaatccaatcgtttcctagatcctactatgacgggagcttaata 41732931  T
117 gcaccagattatcctttaactatattaccttagaatatctttttggatttgtttagttgattgttcttgttc 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41732930 gcaccagattatcctttaactatattaccttagaatatctttttggatttgtttagttgattgttcttgttc 41732859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University