View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10195_high_7 (Length: 289)
Name: NF10195_high_7
Description: NF10195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10195_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 3625224 - 3625501
Alignment:
| Q |
1 |
taatcactctgtatgtgtctctgtcgtcctcggcggagttgtttccatttttgagaagcaactatgagatctaccaagaggtctgcacgcagaatgttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3625224 |
taatcactctgtatgtgtctctgtcgtcctcggcggagttgtttccatttttgagaagcaactatgagatctaccaagaggtctgcacgcagaatgttcc |
3625323 |
T |
 |
| Q |
101 |
ttactcggcttgctcctaggagaatccaaagtcctaaaaagaatctgtttcacagcaactatgaaatctttgttatgatcagatgcagaagatctgaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3625324 |
ttactcggcttgctcctaggagaatccaaagtcctaaaaagaatctgtttcacagcaactatgaaatctttgttatgatcagatgcagaagatctgaact |
3625423 |
T |
 |
| Q |
201 |
gctggcgaaatttggtgtgccgcattaaagcttcatcaattgtgatcatcttctcatcactctccgacctcgcccttt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3625424 |
gctggcgaaatttggtgtgccgcattaaagcttcatcaattgtgatcatcttctcatcactctccgacctcgcccttt |
3625501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University