View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10195_low_19 (Length: 235)
Name: NF10195_low_19
Description: NF10195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10195_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 5625338 - 5625135
Alignment:
| Q |
15 |
cagagacaacgatatctggatagtcatgttccatcactttgaaaggagaaatctctttatacaatcctataaacattaatatcaacatgtcatctgctaa |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5625338 |
cagagacaacgatatctgaatagtcatgttccatcactttgaaaggagaaatctctttatacaatcctataaacattaatatcaacatgtcatctgctaa |
5625239 |
T |
 |
| Q |
115 |
ttcaagtgatgtgaatttaaactccaacatctttctcaaaataaatatagggatttgattttcaagcattactatgtctttcaagattgcattatgacct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5625238 |
ttcaagtgatgtgaatttaaactccaacatctttctcaaaataaataaagggatttgattttcaagcattactatgtctttcaagattgcattatgacct |
5625139 |
T |
 |
| Q |
215 |
aatt |
218 |
Q |
| |
|
|||| |
|
|
| T |
5625138 |
aatt |
5625135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 1978267 - 1978311
Alignment:
| Q |
167 |
atttgattttcaagcattactatgtctttcaagattgcattatga |
211 |
Q |
| |
|
|||||||| |||||||| || ||||||||||| |||||||||||| |
|
|
| T |
1978267 |
atttgattctcaagcataacaatgtctttcaacattgcattatga |
1978311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University