View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10195_low_2 (Length: 436)
Name: NF10195_low_2
Description: NF10195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10195_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 3e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 39849485 - 39849692
Alignment:
| Q |
18 |
ataatagttattaaaccatttgcttatatttgagtccaaaaatttgaatcaaagcccaataatcaatgatcaagatattgtatacttatgtgaaatcaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39849485 |
ataatagttattaaaccatttgcttatatttgagtccaaaaatttgaatcaaagcccaat---caatgatcaagatattgtatacttatgtgaaatcaaa |
39849581 |
T |
 |
| Q |
118 |
caattcattaatacttttctgtataactgaataaaaatcagcagaatttaggaaatnnnnnnncatgcttcaacatcacaattcaagttctcgagcactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39849582 |
caattcattaatacttttctgtataactgaataaaaatcagcagaatttaggaaataaaaaaacatgcttcaacgtcacaattcaagttctcgagcactt |
39849681 |
T |
 |
| Q |
218 |
catgaaacgac |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
39849682 |
catgaaacgac |
39849692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 293 - 418
Target Start/End: Original strand, 39849754 - 39849879
Alignment:
| Q |
293 |
taccatcagtttcgagacaaatccggcactgaatttgttcggaaggaccggcttcgaggtcgatcgaggaaggatcgacgggaggaagaggtgggacgag |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39849754 |
taccatcagtttcgagacaaatccggcactgaatttgttcggaaggaccggcttcgaggtcgatcgaggaaggatcgacgggaggaagaggtgggacgag |
39849853 |
T |
 |
| Q |
393 |
aggagaggtgtctgattctgagtgat |
418 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39849854 |
aggagaggtgtctgattctgagtgat |
39849879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University