View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10195_low_6 (Length: 350)
Name: NF10195_low_6
Description: NF10195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10195_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 19 - 338
Target Start/End: Original strand, 44878411 - 44878730
Alignment:
| Q |
19 |
attgcaccaagcttagactgtcgatatcccttactttttatgtttgaagcagttccaaactcatcaccaacatcttggcaacacgagctacttgatcatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44878411 |
attgcaccaagcttagactgtcgatatcccttactttttatgtttgaagcagttccaaactcatcaccaacatcttggcaacacgagctacttgatcatg |
44878510 |
T |
 |
| Q |
119 |
tgcaagcactgtcactgcactgatcggaatcttagttcctacattactttgatatgcttatattgctcaccaccactcccagtagatggcttagttcatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44878511 |
tgcaagcactgtcactgcactgatcggaatcttagttcctacattactttgatatgcttatattgctcaccaccactcccagtagatggcttagttcatc |
44878610 |
T |
 |
| Q |
219 |
aactgctacactcgttccannnnnnncttcgtttaatgaaccttaaaatatgttttcttttgcgttaatctggtccttttaatttttccatctcatccat |
318 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44878611 |
aactgctacactcgttccatttttttcttcgtttaatgaaccttaaaatatgttttcttttgcgttaatctggtccttttaatttttccatctcatccat |
44878710 |
T |
 |
| Q |
319 |
cattcatcccgttttgccta |
338 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44878711 |
cattcatcccgttttgccta |
44878730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 250 - 333
Target Start/End: Complemental strand, 44879691 - 44879608
Alignment:
| Q |
250 |
tttaatgaaccttaaaatatgttttcttttgcgttaatctggtccttttaatttttccatctcatccatcattcatcccgtttt |
333 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||||| |||| |||||||| ||| ||||| | ||||||||||||| |||| |
|
|
| T |
44879691 |
tttaatgaaccttatgatatgttttcttttccattaatttggttcttttaatatttttatctcgttcatcattcatcccttttt |
44879608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 28920637 - 28920539
Alignment:
| Q |
19 |
attgcaccaagcttagactgtcgatatcccttactttttatgtttgaagcagttccaaactcatcaccaa-catcttggcaacacgagctacttgatca |
116 |
Q |
| |
|
|||||||||||| ||||||||||| || |||| || |||||||||||||||||||||||||| |||| |||||| | ||||||||| | ||||||| |
|
|
| T |
28920637 |
attgcaccaagcacagactgtcgattcaccctactcttgatgtttgaagcagttccaaactcatcgccaagcatcttagtaacacgagcaatttgatca |
28920539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 42891320 - 42891222
Alignment:
| Q |
19 |
attgcaccaagcttagactgtcgatatcccttactttttatgtttgaagcagttccaaactcatcaccaa-catcttggcaacacgagctacttgatca |
116 |
Q |
| |
|
|||||||||||| ||||||||||| || ||||||| |||||||||||||||||| |||||| ||| |||||||| |||||||| || ||||||| |
|
|
| T |
42891320 |
attgcaccaagcacagactgtcgattcaccctacttttgatgtttgaagcagttccatactcattggcaagcatcttggtaacacgagatatttgatca |
42891222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 248 - 300
Target Start/End: Original strand, 29677386 - 29677438
Alignment:
| Q |
248 |
cgtttaatgaaccttaaaatatgttttcttttgcgttaatctggtccttttaa |
300 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||| |||||||| ||||||||| |
|
|
| T |
29677386 |
cgtttaatgagccttaagatctgttttcttttgcattaatctgatccttttaa |
29677438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 248 - 300
Target Start/End: Original strand, 26458584 - 26458636
Alignment:
| Q |
248 |
cgtttaatgaaccttaaaatatgttttcttttgcgttaatctggtccttttaa |
300 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||| |||||||| ||||||||| |
|
|
| T |
26458584 |
cgtttaatgagccttaagatctgttttcttttgcattaatctgatccttttaa |
26458636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University