View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10195_low_9 (Length: 296)
Name: NF10195_low_9
Description: NF10195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10195_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 43501258 - 43501525
Alignment:
| Q |
18 |
acaggcaaaatcagttactagaaaagagtctgcaaaggagttgcaatatcagaatcttgtcaatcacnnnnnnntgatcggaactccccaagaatcgtac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43501258 |
acaggcaaaatcagttactagaaaagagtctgcaaaggagttgcaatatcagaatcttgtcaatcacaaaaaaatgatcggaactccccaagaatcgtac |
43501357 |
T |
|
| Q |
118 |
aaaaatcacagaaaataactcaatattatccgaacttgaggctgccgagttgattagtggttgtagcattgatattcagttatacaagtaagttgaattc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43501358 |
aaaaatcacagaaaataactcaatattatccgaacttgaggctgcagagttgattagtggttgtagcattgatattcagttatacaagtaagttgaattc |
43501457 |
T |
|
| Q |
218 |
atattattgattgtagcattgattatcagctatgcaaaaatctcagaaaagctccaatttagtttcat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43501458 |
atattattgattgtagcattgattatcagctatgcaaaaatctcagaaaagctccaatttagtttcat |
43501525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University