View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_high_14 (Length: 250)
Name: NF10196_high_14
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10196_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 5 - 239
Target Start/End: Original strand, 43382443 - 43382679
Alignment:
| Q |
5 |
gattgtagaactatttgtactcttaaaatggtatgactgtacgaccctaccctaccccgtttgagaataagattttaccacactcatatactagttattc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43382443 |
gattgtagaactatttgtactcttaaaatggtatgactgtacgaccctaccctatcccgtttgaaaataagattttaccacactcatatactagttattc |
43382542 |
T |
 |
| Q |
105 |
tgtatttttctcatatcttacannnnnnnggataaacaaattttagtataataattgttttgt---ttatttattctcgttcaccaaaatctaaacttgg |
201 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
43382543 |
tgta-ttttctcatatcttacatttttttggataaacaaattttagtataataattgttttgttaattatttcttctcgttcaccaaaatctaaacttgg |
43382641 |
T |
 |
| Q |
202 |
tcatttaactcattctcattcaatcttagctcatctct |
239 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
43382642 |
tcatttaactcattctcattcaatataagctcatctct |
43382679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University