View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_high_28 (Length: 218)
Name: NF10196_high_28
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10196_high_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 11018800 - 11018604
Alignment:
| Q |
18 |
acaaggaggtgaaatcattggtccaatacaaaacaatggaggtgttgttccttctggtagacacaaccctgcttttaaagcttttgcagctcttccttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11018800 |
acaaggaggtgaaatcattggtccaatacaaaacaatggaggtgttgttccttctggtagacacaaccctgcttttaaagcttttgcagctcttccttca |
11018701 |
T |
|
| Q |
118 |
atggcatcgaaagtgtttatgataactccatcactttccctcatacttgtcgccatatctaagaaaaccttgtaacttttactctcgcgatccttca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11018700 |
atggcatcgaaagtgtttatgataactccatcactttccctcatacttgtcgccatatctaagaaaaccttgtaacttttactctcacgatccttca |
11018604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 158
Target Start/End: Complemental strand, 11079473 - 11079429
Alignment:
| Q |
114 |
ttcaatggcatcgaaagtgtttatgataactccatcactttccct |
158 |
Q |
| |
|
|||||| |||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
11079473 |
ttcaatagcatcgaaagtgtttacgataatcccatcactttccct |
11079429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University