View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_low_23 (Length: 267)
Name: NF10196_low_23
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10196_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 72 - 251
Target Start/End: Original strand, 310511 - 310690
Alignment:
| Q |
72 |
ggacagtactatatctgagtttagtgtttagtctaaaaccaaaacagagacccataattttattctatgttccatgaaagtgttgtgcaaagttgaggaa |
171 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
310511 |
ggacagtactatatctgagttttgtgtttagtctaaaaccaaaacagagacccataattttattctatgttccatgaaagtgttgtgcaaagttgaggaa |
310610 |
T |
|
| Q |
172 |
aggaattagtgttgttttgttacataaaaagttaaggataaatgttgctgttgtcacaaccaccaccaattcttcatctc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
310611 |
aggaattagtgttgttttgttacataaaaagttaaggataaatgttgctgttgtcacaaccaccaccagttcttcatctc |
310690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University