View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_low_25 (Length: 259)
Name: NF10196_low_25
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10196_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 22 - 249
Target Start/End: Original strand, 7946472 - 7946699
Alignment:
| Q |
22 |
ctggtcatgttgaatcttttagagctccaagtggaagttcatttgcagctgaaagggcataatagtagctacaa-atggccatacaacagactatgggat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
7946472 |
ctggtcatgttgaatcttttagagctccaagtggaagttcatttgcagctgaaagggcataatagtagctacaatatggccatacaacagactattggat |
7946571 |
T |
|
| Q |
121 |
ttcactcaaaagattgtcctgccnnnnnnnnntgtgcttagggtataattctgtttgtgtaaaatgtcctaccattaaatgtttaggctttagtgatttt |
220 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
7946572 |
ttcactcaaaagattgtcctgcc-aaaaaaaatgtgcttagggtataattctgtttgtgtaaaatgtcctactattaaatgtttaggatttagtgatttt |
7946670 |
T |
|
| Q |
221 |
ctttttggattggaatcaggatccctttg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7946671 |
ctttttggattggaatcaggatccctttg |
7946699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 249
Target Start/End: Original strand, 25526580 - 25526655
Alignment:
| Q |
173 |
gtttgtgtaaaatgtcctaccattaaatgtttaggctttagtgattttctttttggattggaatcaggatccctttg |
249 |
Q |
| |
|
|||| ||||||||||||||| ||||||| ||||| | ||||| ||| ||||| |||||||| |||| ||||||||| |
|
|
| T |
25526580 |
gtttatgtaaaatgtcctactgttaaatg-ttaggatgtagtgctttccttttgggattggattcagaatccctttg |
25526655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University