View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_low_26 (Length: 252)
Name: NF10196_low_26
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10196_low_26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 54774575 - 54774814
Alignment:
| Q |
13 |
cagagacaatggcaagcaaaccatttttaatagcaagtgaatgaacctgtctaccagtgtacacaaacacatcacttgtcaatgcacttagaacactagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774575 |
cagagacaatggcaagcaaaccatttttaatagcaagtgaatgaacctgtctaccagtgtacacaaacacatcacttgtcaatgcacttagaacactagt |
54774674 |
T |
|
| Q |
113 |
gagagcaaactcattttgaatctcttcctcacgccgcataagttcaaaaacctcaaccgccttatcagcaatatcactagaagcatacccagaaatcata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774675 |
gagagcaaactcattttgaatctcttcctcacgccgcataagttcaaaaacctcaaccgccttatcagcaatatcactagaagcatacccagaaatcata |
54774774 |
T |
|
| Q |
213 |
gtagcccaagaaaccgtatttctctcaggcattctgtcaa |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54774775 |
gtagcccaagaaaccgtatttctctcaggcattctgtcaa |
54774814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University