View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_low_29 (Length: 250)
Name: NF10196_low_29
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10196_low_29 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 250
Target Start/End: Original strand, 44759231 - 44759474
Alignment:
| Q |
7 |
gaagcagagaagtgggtagtcctgaaataaaatagctgagattttataaattcataacaaacagtattttgtgagtgcagtccaagctcaagctaaaaaa |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
44759231 |
gaagcacagaagtgggtagtcctgaaataaaatagctgagattttataaattcataacaaacagtattttgcgagggcagtccaagctcaagctataaaa |
44759330 |
T |
|
| Q |
107 |
taacaagccttacacataagcaaggcttcaatgaaccaaaatttaatacaacacgcagatgtttggatgttaagtgaaaatatttatagtagttcaaaac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44759331 |
taacaagccttacacataagcaaggcttcaatgaaccaaaatttaatacaacacgcagatgtttggatgttaagtgaaaatatttatagtagttcaaaac |
44759430 |
T |
|
| Q |
207 |
aaggtaacataccagctaaccgagcaacattaacaccgtagctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44759431 |
aaggtaacataccagctaaccgagcaacattaacaccgtagctc |
44759474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University