View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_low_31 (Length: 250)
Name: NF10196_low_31
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10196_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 113 - 236
Target Start/End: Original strand, 42679843 - 42679966
Alignment:
| Q |
113 |
gtgagtgacatggttcaccttacaaactggtggtttaccgtattactaatttatgctttccaagaaacatctttgaatcagaaaactaccttgcctccgg |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42679843 |
gtgagtgacatggttcaccttacaaaccggtggtttaccgtattactaatttatgctttccaagaaacatctttgaatcagaaaactaccttgcctccgg |
42679942 |
T |
 |
| Q |
213 |
cttcttggacaagaatttcgcctc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42679943 |
cttcttggacaagaatttcgcctc |
42679966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 3 - 92
Target Start/End: Original strand, 42679672 - 42679761
Alignment:
| Q |
3 |
ccatcctcctgccatatttctcaaacagctctctgtctctcagagaaagttcaggatggctagttctactggtactggtggtaatggtat |
92 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42679672 |
ccatcctcctgccacatttctcaaacagctctctgtctctcagagaaagttcaggatggctagttctactggtactggtggtaatggtat |
42679761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University