View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_low_34 (Length: 242)
Name: NF10196_low_34
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10196_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 4 - 239
Target Start/End: Complemental strand, 13412676 - 13412442
Alignment:
Q |
4 |
tgaatatattgatctagtaaagtttcatagataaaatgatctaataaagttccataaaaagccctcaatttatttatcatggaaatagtctagcattata |
103 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13412676 |
tgaatatattgatctagtaaa-tttcatagataaaatgatctaataaagttccataaaaagccctcaatttatttatcatggaaatagtctagcattata |
13412578 |
T |
 |
Q |
104 |
accaaaatgcattaaatttattctcatgaaaagaaacacttaaccaagtgtctcaaatttgaatccaagatagatcaacagcgttagcaattttagggat |
203 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
T |
13412577 |
accgaaatgcattaaatttattctcatgaaaagaaacacttaaccaagtgtctcaaatttgaatccaagatagatcaacaacgttaacaattttagggat |
13412478 |
T |
 |
Q |
204 |
tctttgccgtcaatttggatcaaaatatcagtctct |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
13412477 |
tctttgccgtcaatttggatcaaaatatcagtctct |
13412442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University