View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_low_35 (Length: 240)
Name: NF10196_low_35
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10196_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 113 - 223
Target Start/End: Complemental strand, 31737941 - 31737831
Alignment:
| Q |
113 |
tgatgtatgaattatgaaccgtgaaaataactgttcggtttgcctagttgagccaacacattctacacaatagacttctcagctaattggttgaaaacaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31737941 |
tgatgtatgaattatgaaccgtgaaaataactgttcggcttgcctggttgagccaccacattctacacaatagacttctcagctaattggttgaaaacaa |
31737842 |
T |
 |
| Q |
213 |
atgttgaatgt |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
31737841 |
atgttgaatgt |
31737831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 113 - 198
Target Start/End: Complemental strand, 31707676 - 31707591
Alignment:
| Q |
113 |
tgatgtatgaattatgaaccgtgaaaataactgttcggtttgcctagttgagccaacacattctacacaatagacttctcagctaa |
198 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| | |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31707676 |
tgatgcatgaattatgaaccgtgaaaatgactgttcagcttgcctagttgagccaccacattctacacaatagacttctcagctaa |
31707591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 31738053 - 31738001
Alignment:
| Q |
1 |
taggagtgttgattggtgaagcttttttctctcatcaatgcaagtatgcgtga |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31738053 |
taggagtgttgattggtgaagcttttttctctcatcaatgcaaggatgcgtga |
31738001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 53
Target Start/End: Complemental strand, 31707782 - 31707731
Alignment:
| Q |
3 |
ggagtgttgattggtgaagcttttttc-tctcatcaatgcaagtatgcgtga |
53 |
Q |
| |
|
|||||||||| | ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31707782 |
ggagtgttgaattgtgaagctttttttatctcatcaatgcaagtatgcgtga |
31707731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University