View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_low_40 (Length: 229)
Name: NF10196_low_40
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10196_low_40 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 49520055 - 49520277
Alignment:
Q |
7 |
attgtatcaggaaaatattgcatccctgaaagtgatgtcacacttccatcttcacccacttcaacaggatatcgcaaaaggtgagtatttacactttcat |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49520055 |
attgtatcaggaaaatattgcatccctgaaagtgatgttacacttccatcttcacccacttcaacaggatatcgcaaaaggtgagtatttacactttcat |
49520154 |
T |
 |
Q |
107 |
ctaatgcatcatcacagtataatttccaattcctctcagcaacgcggttcaaaagttttacacattccagcctttcaggctcgtcaaaatcatcgctgtt |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49520155 |
ctaatgcatcatcacagtataatttccaattcctctcagcaacgcggttcaaaagttttacacattccagcctttcaggctcgtcaaaatcatcgctgtt |
49520254 |
T |
 |
Q |
207 |
atctccaatgtgttcataccata |
229 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
49520255 |
atctccaatgtgttcataccata |
49520277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University