View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_low_44 (Length: 214)
Name: NF10196_low_44
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10196_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 15 - 173
Target Start/End: Complemental strand, 19086900 - 19086733
Alignment:
Q |
15 |
cataggccagaattagatgcattttctcttgaatctttagaaagcatgctcttttctttgagatatttgtacctttcctgcat------nnnnnnnnntt |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| || |
|
|
T |
19086900 |
cataggccagaattagatgcattttctcttgaatctttagaaagcatgctcttttctttgagatatttatacctctcctgcataaaaaaaaaaaaaaatt |
19086801 |
T |
 |
Q |
109 |
gattaaggtta---atatgatataacttggttagtacaatttataagaaacaaaactacaattcatca |
173 |
Q |
|
|
|||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19086800 |
gattgaggttaattatatgataacacttggttagtacaatttataagaaacaaaactacaattcatca |
19086733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University