View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10196_low_45 (Length: 212)
Name: NF10196_low_45
Description: NF10196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10196_low_45 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 85 - 127
Target Start/End: Original strand, 21872616 - 21872658
Alignment:
| Q |
85 |
caagtgtgatggtgatgatggatgtgtgcgccaaatgagtgtg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21872616 |
caagtgtgatggtgatgatggatgtgtgcgccaaatgagtgtg |
21872658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University