View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_high_17 (Length: 300)
Name: NF10197_high_17
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 130 - 245
Target Start/End: Original strand, 9410384 - 9410499
Alignment:
| Q |
130 |
gtattacatatatagctgcaactattgtatactgcaacatcccaaactacattccaaacatgaattgaatggtttctcctcacttcaaaatggcaatgtt |
229 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9410384 |
gtataacatatatagctgcaactattgtatactgcaacatcccaaactacattccaaacatgaattgaatggtttctcctcacttcaaaatggcaatgtt |
9410483 |
T |
 |
| Q |
230 |
ttaagaatctaaccgt |
245 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9410484 |
ttaagaatctaaccgt |
9410499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University