View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_high_28 (Length: 236)
Name: NF10197_high_28
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_high_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 15154776 - 15154574
Alignment:
| Q |
16 |
atgaatatacagctgctctatgcagtgcaatcgtggatgcttgtaagtaacacaagcatatttaaacaaactcaacatcttgtttaacannnnnnnnnca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15154776 |
atgaatatacagctgctctatgcagtgcaatcgtggatgcttgtaagtaacacaagcatatttaaacaaactcaacatcttgtttaacatttttttttca |
15154677 |
T |
|
| Q |
116 |
cttatctaaccccacatattaaaccctaacgaagaacacactaagttcaggtccattgctattcccatcaggcatcatcatataataagtctctgaatct |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15154676 |
cttatctaaccccacatatcaaaccctaacgaagaacacactaagttcaggtccattgctattcccatcaggcatcatcatataataagtctctgaatct |
15154577 |
T |
|
| Q |
216 |
tta |
218 |
Q |
| |
|
||| |
|
|
| T |
15154576 |
tta |
15154574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 15150274 - 15150189
Alignment:
| Q |
129 |
acatattaaaccctaacgaagaacacactaagttcaggtccattgctattcccatcaggcatcatcatataataagtctctgaatc |
214 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15150274 |
acatatcaaaccctaacgaagaacacactaagttcaggtccgttgctatttccatcaggcatcatcatataataagtctctgaatc |
15150189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University