View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_high_8 (Length: 432)
Name: NF10197_high_8
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 381; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 18 - 414
Target Start/End: Original strand, 36788181 - 36788577
Alignment:
| Q |
18 |
cagagagctggttgtgagataagatgatatctggcccgggctttttgaaagaaccgaatgattctggaattgggcctgtgagtttgtttctgtctaagtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36788181 |
cagagagctggttgtgagataagatgatatctggcccaggctttttgaaagaaccgaatgattctggaattgggcctgtgagtttgtttctgtctaagtg |
36788280 |
T |
|
| Q |
118 |
taaggactcaaggttaggtagctgtgaaagtgagcttgggatcgggcctgagaggttgttggtggaaaggtgaagaagctggaggtttttatgctgggcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36788281 |
taaggactcaaggttaggtagctgtgaaagtgagcttgggatcgggcctgagaggttgttggtggaaaggtgaagaagctggaggtttttaagctgggcc |
36788380 |
T |
|
| Q |
218 |
aagaaaggtggtatcgggcctgagacattggtgtattcaatgaaaagatacttgagtttcgtgagcttggcgatagtgggctggattgggcccgtgagcc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36788381 |
aagaaaggtggtatcgggcctgagacattggtgtattcaatgaaaagatacttgagtttcgtgagcttggcgatagtgggctggattgggcccttgagcc |
36788480 |
T |
|
| Q |
318 |
tggggagtttgtggaattcgagattttcaagataagggaggtcaccgactgaagggggtatagggcctgagagatttgtgtctgggacggaggattg |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36788481 |
tggggagtttgtggaattcgagattttcaagataagggaggtcaccgactgaagggggtatagtgcctgagagatttgtgtctgggacggaggattg |
36788577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University