View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_low_15 (Length: 398)
Name: NF10197_low_15
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 1e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 165 - 380
Target Start/End: Complemental strand, 15137328 - 15137106
Alignment:
| Q |
165 |
gtgtgtataatataggtgggaaggacaaggggcatatgatagatcaagaggaaacagaaggaattggtaatgatttcatttcatgagtgttaataacttg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15137328 |
gtgtgtataatataggtgggaaggacaaggggcatatgatagatcaagaggaaacagaaggaattggtaatgatttcatttcatgagtgttaataacttg |
15137229 |
T |
|
| Q |
265 |
atta-------gnnnnnnnnntggaattaatgatatttttatattgtcatcatttatttagtgattaaaagtttgtgatgttttctataaatgcatgcac |
357 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15137228 |
attataaaaataaaataaaaatggaattaatgatatttttatattgtcatcatttatttagtgattaaaagtttgtgatgttttctataaatgcatgcac |
15137129 |
T |
|
| Q |
358 |
aggatattggtttgggaagatgg |
380 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
15137128 |
aggatattggtttgggaagatgg |
15137106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 15137499 - 15137453
Alignment:
| Q |
1 |
atcaatcaattctatatatagctcaaaatgttcatgtgtagaaaaca |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15137499 |
atcaatcaattctatatatagctcaaaatgttcatgtgtagaaaaca |
15137453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University