View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_low_17 (Length: 359)
Name: NF10197_low_17
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 40 - 181
Target Start/End: Original strand, 51963550 - 51963691
Alignment:
| Q |
40 |
gttgccaaccaattaaaagtgcacttagctccagttcatagcttcattcaatcatgtgatttgagcatcttatatgtggttcacaatagacactattaat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51963550 |
gttgccaaccaattaaaagtgcacttagctcgagttcatagcttcattcaatcatgcgatttgagcatcttatatgtggttcacaatagacactattaat |
51963649 |
T |
|
| Q |
140 |
gaagtgagtgaaatacagtgtgttagtaagttggatcaatat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51963650 |
gaagtgagtgaaatacagtgtgttagtaagttggatcaatat |
51963691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 248 - 348
Target Start/End: Original strand, 51963758 - 51963858
Alignment:
| Q |
248 |
caatattattttaaacctttctttgaaacgaataaagcaatgagaataactatagcagcaaagaaattatgctgaattttggtttaatagtaaatgttca |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
51963758 |
caatattattttaaacctttctttgaaacgaataaagcaatgagaataattatagcagcaaaaaagttatgctgaattttggtttaatagtaaatgttca |
51963857 |
T |
|
| Q |
348 |
t |
348 |
Q |
| |
|
| |
|
|
| T |
51963858 |
t |
51963858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University