View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_low_22 (Length: 335)
Name: NF10197_low_22
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 314
Target Start/End: Original strand, 10619583 - 10619896
Alignment:
| Q |
1 |
catggaagacaccggaacaaccgttgatggcgtttgagacggcggtggagtcgaggatgttaacggggaagatggtgatgcgagattgggcttcgtggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10619583 |
catggaagacaccggaacaaccgttgatggcgtttgagacggcggtggagtcgaggatgttaacggggaagatggtgatgcgagattgggcttcggggtg |
10619682 |
T |
 |
| Q |
101 |
gagtgtgaaaagatgagatgggtcggaattggggaagattgtagcgtggattttgtagtgtgggttttgtttagataatagggtgtgaactagccatgat |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10619683 |
gagtgtgaaaagatgagatggatcggaattggggaagattgtagcgtggattttgtagtgtgggttttgtttagataatagggtgtgaactagccatgat |
10619782 |
T |
 |
| Q |
201 |
ccgatgaatccgtttgctccggttacgcataccacctcttctctgttttcgcttgccatctccgtatctgcttctagccatgaactagctcacaatcttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10619783 |
ccgatgaatccgtttgctccggttacgcataccacctcttctctgttttcgcttgccatctccgtatctgcttctagccatgaactagctcacaatcttt |
10619882 |
T |
 |
| Q |
301 |
gcattggagttgct |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10619883 |
gcattggagttgct |
10619896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University