View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_low_28 (Length: 294)
Name: NF10197_low_28
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 18 - 137
Target Start/End: Complemental strand, 26600734 - 26600615
Alignment:
| Q |
18 |
gcctttcccgaaactaaagagtcttgcttttctttcggtttcaacgttttttaaaagttgaaataaaccggactaaattgatgacattcgatttgatttg |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||| | ||||||||||| ||| |||||||| |||||||||||||||||||||||| || |
|
|
| T |
26600734 |
gccttttccgaaactaaagagtcttgcttttctttcgatttcaagatattttaaaagttaaaacaaaccggattaaattgatgacattcgatttgatctg |
26600635 |
T |
|
| Q |
118 |
attccgttgatcggatcatc |
137 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26600634 |
attccgttgatcggatcatc |
26600615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 228 - 281
Target Start/End: Complemental strand, 26600557 - 26600504
Alignment:
| Q |
228 |
ccaatacgaaagtatgggaagatccatcctagagtggaaattacttgaacattc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26600557 |
ccaatacgaaagtatgggaagatccatcctagagtggtaattacttgaacattc |
26600504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University