View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_low_31 (Length: 272)
Name: NF10197_low_31
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 11 - 66
Target Start/End: Original strand, 7917179 - 7917234
Alignment:
| Q |
11 |
agcataggtgcaaggttaaaaattgaggatattcaaattatgtataaactacgaaa |
66 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7917179 |
agcaaaggtgcaaggttaaaaattgaggatattcaaattatgtataaactacgaaa |
7917234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University