View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_low_35 (Length: 253)
Name: NF10197_low_35
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 41573358 - 41573128
Alignment:
| Q |
1 |
aaaactggtaataataaaaaagcctctcaaaagcagaagaagcaacgcaacaccgatgaatcaaagttacattcaccttcttctgatgagaaacaacgct |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41573358 |
aaaactggtaataataaa---gcctctcaaaagcagaagaagcaacgcaacaccgatgaatcaaagttacattcaccttcttctgatgagaaacaacgtt |
41573262 |
T |
 |
| Q |
101 |
tctcaaaggaagcaattgaaaagtatttgaaaaaggttaagcctctgtacataaaagtttctcgaaagtatgcagagaagctcaagttttctggacatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41573261 |
tctcaaaggaagcaattgaaaagtatttgaaaaaggttaagcctctgtacgtaaaagtttctcgaaagtatgcagagaagctcaagttttctggacatct |
41573162 |
T |
 |
| Q |
201 |
aaacacatcgtcggtgaagaatgacgcggcggag |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
41573161 |
aaacacatcgtcggtgaagactgacgcggcggag |
41573128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University