View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_low_45 (Length: 240)
Name: NF10197_low_45
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 229
Target Start/End: Original strand, 22905819 - 22906031
Alignment:
| Q |
17 |
acaccacttttaggatgtccttagaaatgacataaggatggaaatggagtaaattctaaatttgtttaagaaattattcgaaggtattgaaaaccacata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22905819 |
acaccacttttaggatgtccttagaaatgacataaggatggaaatggagtaaattctaaacttgtttaagaaattcatcgaaggtattgaaaaccacata |
22905918 |
T |
|
| Q |
117 |
ttactatggcagaaaggcaaatcattacattagatgtctacattttgagagcattcttaggtatttttaacaaataataacaaccagtggtataattcac |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22905919 |
taactatggcagaaaggcaaatcattacattagatgcctacattttgagagcattcttaggtatttttaacaaataataacaaccagtggtataattcac |
22906018 |
T |
|
| Q |
217 |
agtgactcaacac |
229 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
22906019 |
agggactcaacac |
22906031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University