View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10197_low_6 (Length: 483)
Name: NF10197_low_6
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10197_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 199 - 473
Target Start/End: Original strand, 31938207 - 31938480
Alignment:
| Q |
199 |
agtatattggtgtgttgatttagaggaagtgtgatctttaataagttgtgattgttgtgtaggaatataagttggtgagtgtgggcttcacgtttttgag |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31938207 |
agtatattggtgtgttgatttagaggaagtgtggtctttaataagttgtgattgttgtgtaggaatataagttggtgagtgtgggcttcacgtttttgag |
31938306 |
T |
|
| Q |
299 |
tgatggaattggaatggaaatggcatggcaataagatggatgcatttcaacacattgcacgcgttaatagaagcagacttgtctttggctttgtaatgtg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
31938307 |
tgatggaattggaatggaaatggcatggcaataagatggatgcatttcaacacattgcacgcgttaatagaagcaga-ttgtctttagctttgtaatgtg |
31938405 |
T |
|
| Q |
399 |
accatttcttttaatttaaaaaagcattttagttagataaaaacatacacatagttgattaaacattatcctatg |
473 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31938406 |
accatttcttttaatttaaaaaagcattttagttagataaaaacatacacatagttgattaaacattatcctatg |
31938480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 2 - 94
Target Start/End: Original strand, 31938032 - 31938124
Alignment:
| Q |
2 |
aaccgtctaatgaaggttgaatggttgaaatctaattatgttttgaagttgatctgtagagtttaagtactggtcattggatgaagattgaac |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
31938032 |
aaccgtctaatgaaggttgaatggttgaaatctaattatgttttaaagttgatttgtagagtttaagtactagtcgttggatgaagattgaac |
31938124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University