View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10198_high_7 (Length: 296)
Name: NF10198_high_7
Description: NF10198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10198_high_7 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 92 - 296
Target Start/End: Complemental strand, 9390167 - 9389963
Alignment:
| Q |
92 |
aaggaaaatttatcatgtacccttacacttataccttcacccctacaaaccacgagactttcaatattaacacttttgttatatgatttcgccctaatnn |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9390167 |
aaggaaaatttatcatgtacccttacacttataccttcacccctacaaaccaccagactttcaatattaacacttttgttatatgacttcgccctaataa |
9390068 |
T |
 |
| Q |
192 |
nnnnntccagtttgtaaaagttttccgaaaaacttgagttaaattttccgataggtaaaccaatccaaaattccagattctacatctctttattttcttc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9390067 |
aaaaatccagtttgtaaaagttttccgaaaaacttgagttaaattttccgataggtaaaccaatccaaaattccagattctacatctctttattttcttc |
9389968 |
T |
 |
| Q |
292 |
tttat |
296 |
Q |
| |
|
||||| |
|
|
| T |
9389967 |
tttat |
9389963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 9390198 - 9390164
Alignment:
| Q |
1 |
ttatatatatgattattgatccacaaagagcaagg |
35 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9390198 |
ttatatatatgatcattgatccacaaagagcaagg |
9390164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University