View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10198_low_11 (Length: 257)
Name: NF10198_low_11
Description: NF10198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10198_low_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 14 - 257
Target Start/End: Complemental strand, 51218694 - 51218450
Alignment:
| Q |
14 |
cagagatgaagggtttggacggagcggcggtggaaaaaagaataagaattaaaattaatt-gagattttaggtcgcaaattttgtatttatagatgagtt |
112 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51218694 |
cagagatgaaaggcttggacggagcggcggtggaaaaaagaataagaattaaaattaatttgagattttaggtcgcaaattttgtatttatagatgagtt |
51218595 |
T |
 |
| Q |
113 |
taggtcgctaattgtgtattcttttaggcaattatttttctcaccatactttctttgcccttagtcttattcacagcatatttttgatgtttgtgtttat |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51218594 |
taggtcggtaattgtgtattcttttaggcaattatttttctcaccatactttctttgcccttagtcttattcccagcatatttttgatgtttgtgtttat |
51218495 |
T |
 |
| Q |
213 |
taattcgaactagaaaaacacgatttagaatccttgtagtgggtt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51218494 |
taattcgaactagaaaaacacgatttagaatccttgtagtgggtt |
51218450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University