View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10198_low_13 (Length: 251)
Name: NF10198_low_13
Description: NF10198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10198_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 9389879 - 9389676
Alignment:
Q |
1 |
aatcatggtccctttctcaatgcaatcacttgatctaaataggggatcattgtctcaagtgccaattagcctacatatcatcttattttgttgaggaatc |
100 |
Q |
|
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
9389879 |
aatcatggttcctttctgaatgcaatcacttgatctaaataggggatcattgtctcaagtgccaattagcctacatatcatctta-tttgttgaggaatc |
9389781 |
T |
 |
Q |
101 |
catcataaatcaatgaagttttcatgacctcgccctatcatatatccactcaaccaagcaccgaattttgcaggacgacgacaattccgtaaacagttta |
200 |
Q |
|
|
|||||||||||||||| || | ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9389780 |
---cataaatcaatgaagtgccaat----tagccctatcatagatccactcaactaagcaccgaattttgcaggacgacgacaattccgtaaacagttta |
9389688 |
T |
 |
Q |
201 |
tagaacttctat |
212 |
Q |
|
|
||||||||||| |
|
|
T |
9389687 |
gagaacttctat |
9389676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University