View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10199_high_10 (Length: 239)
Name: NF10199_high_10
Description: NF10199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10199_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 40184583 - 40184806
Alignment:
| Q |
1 |
ttctccactgacaatcagcttgataatctccccttcgactctcgactcttcgcgttgaattgctttctgcccgacctcctggtaagtacagggagcgtcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40184583 |
ttctccactgacaatcagcttgataatctccccttcgactctcgactcttcgcgttgaattgctttctgcccggcctcctggtaagtacagggagcgtcg |
40184682 |
T |
|
| Q |
101 |
tcttcatcatcgtcagagccaaaaaggaaatcctcgaaggattttcgggaagggctgttgtcgtcattgacgttgtctggatcgtgaagttgaannnnnn |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40184683 |
tcttcgtcatcgtcagagccaaaaaggaaatcctcgaaggattttcgggaagggctgttgtcgtcattgacgttgtctggatcgtgaagttgaatttttt |
40184782 |
T |
|
| Q |
201 |
ncatcagggtttcgagtaagagat |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40184783 |
tcatcagggtttcgagtaagagat |
40184806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University