View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10199_low_12 (Length: 250)
Name: NF10199_low_12
Description: NF10199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10199_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 41330119 - 41330357
Alignment:
| Q |
1 |
caacaggttggaccctttttccaccccttaacaatcattaaccctgtttaaagagacgtgacaggagtcaacagccaaagactatgaagatcaatttgtt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41330119 |
caacaggttggaccctttttccaacccttaacaatcattaaccctgtttaaagagacgtgacaggagtcaacagccaaagactacgaagatcaatttgtt |
41330218 |
T |
|
| Q |
101 |
gtaggcctcaagctcacataagtggagatatatgaaccatacatagaacttctcttatgagtggagatatatccccacttttccactttagtgcctgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41330219 |
gtaggcctcaagctcacataagtggagatatatgaaccatacatagaacttctcttatgagtggagatatatccccacttttccactttagtacctgatt |
41330318 |
T |
|
| Q |
201 |
gataaacaccacgtagtgctcgtcattttctccattcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41330319 |
gataaacaccacgtagtgctcgtcattttctccattcat |
41330357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University