View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10199_low_18 (Length: 239)
Name: NF10199_low_18
Description: NF10199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10199_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 25 - 222
Target Start/End: Complemental strand, 36205407 - 36205210
Alignment:
| Q |
25 |
gagaatgattgaaaacgtaaattctctggaggagaaaaagtagtttgaaatccctggtgtgtacttttagataattgattgagactttctgttatttatg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
36205407 |
gagaatgattgaaaacgtaaattctctggaggagaaaaagtagtttgaaatccctggtgtgtacttgaaaataattgattgagactttatgttatttatg |
36205308 |
T |
 |
| Q |
125 |
tttcaatatttccacaatttataataaaagatgctaccaaattaattaaacaggttatttgagattatgttaatttgataaagaaaatagatagcaaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||||| |||| | |||||| |
|
|
| T |
36205307 |
tttcaatatttccacaatttataataaaagatgctacctaattaattaaacgggttatttgatattatgttaatttgataaagagaatatagagcaaa |
36205210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 53 - 114
Target Start/End: Complemental strand, 36208492 - 36208431
Alignment:
| Q |
53 |
gaggagaaaaagtagtttgaaatccctggtgtgtacttttagataattgattgagactttct |
114 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
36208492 |
gaggagaaaaactagtttgaaacccctggtgtgtacttgtagataattgattgagcctttct |
36208431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University