View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10199_low_22 (Length: 229)
Name: NF10199_low_22
Description: NF10199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10199_low_22 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 115 - 229
Target Start/End: Original strand, 36632418 - 36632532
Alignment:
| Q |
115 |
caaacaaactcacgagaagcccatacaaataaaactaaatatcttaatgcgtcttttcgtttgacattaattattatctatgcattgtggctcatgtgtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36632418 |
caaacaaactcacgagaagcccatacaaataaaactaaatatcttaatgcgtcttttcgtttgacattaattattatctatgcattgtggctcatgtgtt |
36632517 |
T |
 |
| Q |
215 |
aacaaaattaataat |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36632518 |
aacaaaattaataat |
36632532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 7 - 87
Target Start/End: Original strand, 36632337 - 36632417
Alignment:
| Q |
7 |
tgtttcactcgcttcaaaagaacctattaacaattcatgaatccatttttgcattgtctccatttgaaattttttgctact |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36632337 |
tgtttcactcgcttcaaaagaacctattaacaattcatgaatccatttttgcattgtctccatttgaaattttttgctact |
36632417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University