View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10200_low_15 (Length: 249)
Name: NF10200_low_15
Description: NF10200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10200_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 30785956 - 30785726
Alignment:
| Q |
1 |
agctcaccaactcctctttctctgtttctggttcgtatactatactatactatacaagtttatattcatgaatcannnnnnnnctcttattcaagtttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30785956 |
agctcaccaactcctctttctctgtttctggttcgtatactatactatac-----aagtttatattcatgaatcattttttttctcttattcaagtttaa |
30785862 |
T |
 |
| Q |
101 |
taattttcactctactactcttcacagggaaccaatccaaaacaaaatcaccaagcatctcagaaactcacattatcattgggtgaatcagtgtctagtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30785861 |
taattttcactctactactcttcacagggaaccaatccaaaacaaaatcaccaagcatctcagaaactcgcattatcattgggtgaatcagtgtctagtg |
30785762 |
T |
 |
| Q |
201 |
cagctctagttgctcttctatctgcttctctcttct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30785761 |
cagctctagttgctcttctatctgcttctctcttct |
30785726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University