View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10200_low_21 (Length: 215)
Name: NF10200_low_21
Description: NF10200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10200_low_21 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 34899708 - 34899922
Alignment:
Q |
1 |
tataataagataggcaagagataccaaattatcatattgtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34899708 |
tataataagataggcaagagataccaaattatcatattgtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttc |
34899807 |
T |
 |
Q |
101 |
atgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34899808 |
atgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaa |
34899907 |
T |
 |
Q |
201 |
gaactaaagagagat |
215 |
Q |
|
|
||||||||||||||| |
|
|
T |
34899908 |
gaactaaagagagat |
34899922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University