View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10200_low_9 (Length: 348)
Name: NF10200_low_9
Description: NF10200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10200_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 146 - 340
Target Start/End: Original strand, 31832960 - 31833154
Alignment:
| Q |
146 |
aatgaggatgatgataacttggccaccaagtgtggcagaaagtcttactaaagactggacttggtcaacaagaaaggaaggatcctagcaactacca-tg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
31832960 |
aatgaggatgatgataacttggccaccaagtgtggcagaaagtcttactaaagactggacttggtcaacaagaaaggaaggatcgtagcaactaccattg |
31833059 |
T |
|
| Q |
245 |
agtcatgtttgnnnnnnnnnnggcnnnnnnnagtggatttgatgtgtaaaaggtcacatcaaatacggtacaattgaagttctcatgtttcatctc |
340 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31833060 |
agtcatgtttg-aaaaaaaatggcgacttttagtggatttgatgtgtaaaaggtcacatcaaatacggtacaattgaagttctcatgtttcatctc |
31833154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 18 - 107
Target Start/End: Original strand, 31832835 - 31832924
Alignment:
| Q |
18 |
atttgaaggtggaagagaaattataacaacacttttgagttgtggtgattcatcatcttccatatctcagtaaaattgttactaaaagtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31832835 |
atttgaaggtggaagagaaattataacaacactcttgagttgtggtgattcatcatcttccatatctcagtaaaattgttactaaaagtg |
31832924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University