View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_high_14 (Length: 352)
Name: NF10201A_high_14
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 7 - 340
Target Start/End: Original strand, 34314390 - 34314723
Alignment:
| Q |
7 |
caaaagaggagtattatatcaagtgaacaatttgtttgtgagagttcacgatggttgatattgtaaatatgtttgagaatcagttaatttgtgatcattc |
106 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
34314390 |
caaaagaggagtgttatatcaagcgaacaatttgtttgtgagagttcacgatggttgatattataaatatgtttcggaatcagctaatttgtgatcattc |
34314489 |
T |
 |
| Q |
107 |
tgtctgaatctctattgtaacttttctgctattttctcttacatactttatgttaaggaaatagtctctttgtttttaatatattccgttttgatttctt |
206 |
Q |
| |
|
||| ||||||||||| |||||||||| |||| |||||||||||| |||||| ||||| ||||| ||||| ||| |||||||||| | |||||||||| | |
|
|
| T |
34314490 |
tgtatgaatctctatcgtaacttttcgactatcttctcttacatattttatgctaagggaatagactcttagttcttaatatatttcattttgatttcgt |
34314589 |
T |
 |
| Q |
207 |
nnnnnnnnnnntagaaattaata--atatatactactctcttgtatcaagttgtcattattattcaagactttgtattttattggaattgcagtctcatt |
304 |
Q |
| |
|
||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34314590 |
--aaaaaaaaataggaattaataatatatatactactctcttgtatcaagttgtcattattattcaagactttgtattttattggaattgcagtctcatt |
34314687 |
T |
 |
| Q |
305 |
ctttatcttctttattcttctctataagtctatatt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34314688 |
ctttatcttctttattcttctctataagtctatatt |
34314723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University