View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_high_26 (Length: 271)
Name: NF10201A_high_26
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 256
Target Start/End: Complemental strand, 11565736 - 11565499
Alignment:
| Q |
19 |
gagtgaaatgaacggatagagattagatcgagggtgggaaatggtgcatagacatgaacgacggaaatggcgcagattgtggtgagttatggggaacaga |
118 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11565736 |
gagtgaaatgaacggatagatattagatcgagggtgggaaatggtgcatagacatgaacgacggaaatggcgcagattgtggtgagtaatggggaacaga |
11565637 |
T |
|
| Q |
119 |
ggattaactgcgttgtggtagttcgggttcgtcgaagaagttgtgtttcacgtgaatggatagataataggtattgataactgattgagtaaagaagaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11565636 |
ggattaactgcgttgtggtagttcgggttcgtcgaagaagttgtgtttcacgtgaatggatagataataggtattgataactgattgagtaaagaagaaa |
11565537 |
T |
|
| Q |
219 |
caagtgtttaattccaacaatttgtagtgcacttgcat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11565536 |
caagtgtttaattccaacaatttgtagtgcacttgcat |
11565499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University