View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_high_32 (Length: 243)
Name: NF10201A_high_32
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_high_32 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 6 - 243
Target Start/End: Complemental strand, 41705158 - 41704921
Alignment:
| Q |
6 |
gtatggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatcagtcacttcctttcaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705158 |
gtatggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatcagtcacttcctttcaa |
41705059 |
T |
|
| Q |
106 |
cataacttcatccaacacagtgttcattttcaactgttcccctcgtctcttggtttctcctcttaactgctcttcctctagtatttgtcaccgttacttg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705058 |
cataacttcatccaacacagtgttcattttcaactgttcccctcgtctcttggtttctcctcttaactgctcttcctctagtatttgtcaccgttacttg |
41704959 |
T |
|
| Q |
206 |
gaaaattcaggtcatgttgacacaaatcgagcacttga |
243 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41704958 |
gaaaattcaggtcaagttgacacaaatcgagcacttga |
41704921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 8 - 90
Target Start/End: Complemental strand, 1453347 - 1453265
Alignment:
| Q |
8 |
atggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatca |
90 |
Q |
| |
|
|||||| ||||||||| |||||||||||| ||||||||||||||||||| |||| ||||||||||| ||||| |||||||| |
|
|
| T |
1453347 |
atggtggtgcagccacaaccttggttacctggttcatgtgtcacacaaggcatgttggtaagcaatgatatttacttaaatca |
1453265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 8 - 90
Target Start/End: Complemental strand, 1465039 - 1464957
Alignment:
| Q |
8 |
atggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatca |
90 |
Q |
| |
|
|||||| ||||||||| |||||||||||| ||||||||||||||||||| |||| ||||||||||| ||||| |||||||| |
|
|
| T |
1465039 |
atggtggtgcagccacaaccttggttacctggttcatgtgtcacacaaggcatgttggtaagcaatgatatttacttaaatca |
1464957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 63
Target Start/End: Complemental strand, 7564146 - 7564110
Alignment:
| Q |
27 |
cttggttacccggttcatgtgtcacacaagacatgcc |
63 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
7564146 |
cttggttacctggttcatgtgttacacaagacatgcc |
7564110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University