View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_high_35 (Length: 218)
Name: NF10201A_high_35
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_high_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 18175814 - 18175664
Alignment:
| Q |
23 |
accacaacaaccaatggcaatattgatgtcacaagttagatattcagatcttaaactagatatacattcaattggatcattgtttagacccaatttatgt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18175814 |
accacaacaaccaatggcaatattgatgtcacaagttagatattcagatcttaaactagatatacattcaattggatcattgttgagacccaatttatgt |
18175715 |
T |
 |
| Q |
123 |
gattacttttggttataatt--tataaataagataagatggagtattatct |
171 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| || ||||||||| |
|
|
| T |
18175714 |
gattacttttggttataatttatataaataagataagaaggtgtattatct |
18175664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University