View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_134 (Length: 276)
Name: NF10201A_low_134
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_134 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 44999393 - 44999134
Alignment:
| Q |
1 |
atttttgttaaaatgttgtgttcttaatgttttattgtgtaatttcaattatagggctcacgaattggagtttatggatcaaattgtcctcagtggattg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999393 |
atttttgttaaaaggttgtgttcttaatgt--------gtaatttcaattatagggctcacgaattggagtttatggatcaaattgtcctcagtggattg |
44999302 |
T |
|
| Q |
101 |
tggcaatggaggttcccatttctatataacgttctcacatttctttatttatttattttttccttccttctatatatgattgtgttctattataattcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999301 |
tggcaatggaggttcccatttctatataacgttctcacattt----atttatttattttttccttccttctatatatgattgtgttctattataattcat |
44999206 |
T |
|
| Q |
201 |
aaacttgtttatgttgatgtatgtaggcttgttgcgcccatagcttggtttgtgtgcctctctatgatactc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999205 |
aaacttgtttatgttgatgtatgtaggcttgttgcgcccatagcttggtttgtgtgcctctctatgatactc |
44999134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University