View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10201A_low_150 (Length: 264)
Name: NF10201A_low_150
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10201A_low_150 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 13 - 254
Target Start/End: Original strand, 43410762 - 43411010
Alignment:
| Q |
13 |
atatgaacaacttggttctaaaatatttggatgatgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagacttgcacacatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410762 |
atatgaacaacttggttctaaaatatttggatgatgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagacttgcacacatc |
43410861 |
T |
 |
| Q |
113 |
atctcacacacgtaccattagactctctctttttcaagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtccatcctc---- |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410862 |
atctcacacacgtaccattagactctctctttttcaagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtccatcctcctag |
43410961 |
T |
 |
| Q |
209 |
ctagctagcttacaacttc---tcatctgaatgtgttgtgtctgtctgt |
254 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43410962 |
ctagctagcttacaacttctgatcatctgaatgtgttgtgtctgtctgt |
43411010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University